Incredibulous

Ye Hai Mumbai Meri Jaan

2009-08-16T22:14:00.020+05:30

Hoo boy! Long time since I got a chance to update the blog so I had to make do with publishing super long posts:-

Two rickshaws it took to take us all to the Surathkal railway station, one just for the immense amount of luggage we had- thanks mainly to my 3 bags weighing a total close to 65 Kg. The train, Matsyaganda Express No. 2620, came on time, ie, 1:30 pm on 10-08-2009 and seats 25,26,28 and 29 were ours in AC compartment B-3.

Yet again I see there is a girl sharing our compartment. Now this may surprise quite a few but I can without doubt confirm she was the prettiest girl I had ever seen in person. She was on the other side of the compartment alongside a guy who I earlier thought was her boyfriend but was not at all related to her. No, I don’t even know her name and by the time I got down at Mumbai I was kinda glad for that!

Why can’t beauty and brains co-exist often? This one was selfish AND lazy. Don’t ask, I won’t elucidate: Simply not worth it… Lets just be satisfied that she was a physiotherapist for the National Girls Football Team (We actually have one??) and nothing close to Chak de India. The guy on the other hand was really nice: He was Nithin who was studying Master’s in Medicine in Bangalore and had come to Mangalore to attend a medical conference and was on way to Mumbai for another conference.

The other two sharing the compartment were two Gults who rarely came down from the top berths and spent their time watching whole movies on their Nokia mobiles (See even Gults recognise the superiority of Nokia!).

The only eventful thing during the train journey was the juggling of the luggage between the spaces beneath the seat and otherwise and so it was that at 6:47 am on 11-08-2009 that I stepped onto the soils of the greatest city in India: Mumbai!

Oh sure some may have other opinions on which city is greater but as I spent 4 days here I can understand what my friend Dhole was telling when he called me lucky for having got a job at BPCL, Mumbai just for being able to live here. This is truly the city of dreams- some become true, others are shattered- and amidst all the chaos that was prevailing every time combined with the Swine Flu epidemic and Independence Day/ Ganesh Chathurti celebrations coming up I was convinced this place more than anything else epitomises India: The Good, The Bad and The Ugly of it all!

Its funny how people here take time for granted, I stayed at my dad’s bank’s holiday home – Nugget – at Prabhadevi, right opposite the headquarters for the Shiv Sena newspaper Dainik Samna and I had to walk a kilometre in Mumbai to find a decent place to eat.

Dainik Samna Headquarters

I know this is really rare and can happen only to me but I enjoyed the excuse to walk and notice how a vegetable market exists right next to a construction site; how a temple is next to a chicken centre and how a 50 floor skyscraper stands next to a slum colony.

Day 1 and a visit to the famous Siddhi Vinayak Temple nearby showed the fascination people here have with the Lord Ganesha.

Siddhivinayak Temple, Mumbai

Day 2 was a lot more interesting as we had hired a tourist cab to take us around Mumbai…

What the N-95??

I have to admit it: Even now the first thing that pops in my mind when I hear/see the letters “N-95” is a big, bulky Nokia multimedia handset that failed spectacularly in India. However the latest fashion accessory over here is the variety of face masks to “help prevent” contraction of Swine flu. The types of masks available on the street are mind-boggling ranging from a simple piece of cloth attached to a string (Rs 10-40, depending on the vendor and street) to a full head gas mask with nano-charcoal filters (> Rs 5k). But one thing common to all the vendors is that none of them use their own products; infact they have nothing to cover their nasal cavities at all! One has to wonder whether its because they themselves have no confidence in the products they are selling to the public but I was glad to see even the most paranoid ones to be using mostly handkerchiefs/ Dupatta’s whereas the majority of them (Like us) are willing to brave the elements.

Our Driver’s Comments

Hailing from the mighty city of Ranchi, Jharkhand our driver made no efforts to keep his thoughts to himself. We were close to the jail where the terrorist Kasab was held and he begins his monologue about how the govt is spending lakhs for his upcoming and how if it were upto him and his friends, Kasab would never see the light of another day again! Sad to say the feelings are shared by nearly everyone in this majestic city; I cant ever hope to understand given I was safely some 800 Km away on 26-11-2008.

Just as I thought he was against only terrorists, he then went on to generalise Muslims as the cause of everything dirty and evil in the city: No comments from me! I am generally against all this anti-Islam talk but this city is ruled by that old Shiv Sena tiger Bal Thackeray and his fist is everywhere here whether you choose to believe it or not.

He then led us to the Mahalaxmi Temple and delivered another lecture on how the youth of today no longer care for religion: I had a funny feeling he saw straight through me! Just to make his point the next stop was the nearby Iskon Temple where I decided to make up for Mr Goody-Goody and snapped a few pics of the idols with a few guards around me when it was clearly prohibited J

Water Place

Main Idols

Part of a wall collection

While on the way to the Gateway of India, he pointed out the homes of a few bollywood stars (SRK, Salman Khan, Abhishek Bacchan) as well as those of some MP’s, Cabinet Ministers and other VVIP’s and at the same time doling more speeches on what he thought of each of them and their assured high security level leaving the general public in harm’s way. But wait- he was not done yet…

On the way to the Gateway of India, he drove very slowly around Nariman Point and showed all the spots of the attack, then showed the Oberoi Trident and finally somehow got us through a security cordon (albeit very lax) around the Taj International at the Gateway of India to show the destruction still very present. Upon seeing a few French guys taking snaps there, he gave a lecture to everyone present about how we treat the Firangi better than ourselves in our own country- This guy was a fiery patriot!

Taj International (Old)

Oberoi Trident

Pigeons are a constant presence here

But not when they fly off!

Gateway of India

The Wharf at the Gateway

Mumbai’s Splendour?

As a tourist in Mumbai, there is very little you can do. It took about 5 hours to cover everything we wanted to see and it was pretty boring mostly. The world famous Juhu beach was covered with filth when we arrived there (~9 am) and cleaning crews around told us it was a daily routine for them to remove such vast amounts of garbage every morning after it was left behind by the tourists the previous evening/night but it was clear the beach was losing its popularity swiftly.

Family at Juhu Beach

And trash at Juhu Beach

Sure you got your usual temples/places of worship around and there is Crawford Market for the greatest deals if you are into shopping. But despite the lack of rainfall this year in this place, the busiest people around were clearly the municipal cleaners: Mumbai has its posh areas, but the vast majority of the city is dirty L

One funny thing I noticed right next to the Mahalaxmi Temple was an “Ancient Shiva Temple” which had its email id being advertised!

"Ancient Temple" with Email Id

I did manage to have my share of good cuisine- local and otherwise- here, from the never-to-be-missed Vada Pav to the Chicken Sauthe and Crispy Schezwan Masala Dosa that had a Manchurian twist to the Bhaji instead hehe.

But nothing was as majestic as the Sea-Link:-

Entering the Sea-Link

A vision of the supports

Rendering me speechless

I can use the fingers on a single hand to remember the times I have been left truly speechless! Infact I talk so much and often that my friends once took a record of the time I spend talking in an average free hour (48 mins was the record I believe). Day 3 in Mumbai and it was spent visiting friends/colleagues of my dad who had arranged the entire trip for us. One such visit was to a Jain family who had stayed over at our house this March and I was interested to learn their daughter-in-law of 4 months was a fashion designer for SONY entertainment channel with her most famous work being on the set of Comedy Circus. Imagine getting to talk to superbly talented comedians like Shakeel! Anyway we were off to leave and she comes carrying a very expensive book of novels to gift me: I had no idea they were even aware of my reading habits but I was so stunned getting such a great gift from relative strangers that I could only smile for the next 2-3 mins.. The book is titled “The Secret” and I plan to read it during the flight.

Govinda aala re

Krishna Janmashtami is celebrated with pomp all over the nation but there is something so passionate with the way Mumbai-kars celebrate anything! Day 4, and my last day in India for some time, saw the entire place erupt in a humongous roar of music, colours and the lot. Maybe it was because this place was Shiv Sena territory but there was saffron everywhere the naked eye could see. There were also groups in white, green, yellow, blue and all sorts of colours: Mainly these groups went about in hired trucks/vans with their own bands to do the famous Matka Phod while onlookers in flats from above showered them with water as they attempted the human pyramids.

Neighbourhood buildings throbbing with on-lookers

A Van of Participants

A Band Playing

Of course I did not have my phone out in my hands during the actual Matka-Phod, but you get the picture. After the gala was over, it was time for check-out and a half hour cab ride to Chattrapathi Shivaji International Airport where, to my great delight, my old classmates Arun and Preet were there to bid me farewell.

Preet and Arun

Varun + Arun FTW!

Ok Arun sucks at Photography

After they left at about 7:30 pm, it was time to enter the gate which meant farewell to my family (Well except my Dad who had arranged with the bank’s Public Relations Officer to grant him access inside till the Immigration/Emigration desk. Things got senti (Not for me, surprisingly) and I officially stepped out of Indian Shores once I stepped into the airport… Adieu India!

Departure, atlast!

2009-08-10T06:54:00.009+05:30

I have been dreading the day I write this post: Mostly because its the fear of the unknown. Now I dont scare easily, but not knowing whats next is pretty intimidating!

I see my dad in front of me taking calls from many a family member who couldnt make it to last night's get-together, and my mom in the next room making sure everything is packed for the 100th time despite atleast 1 item not being packed- My laptop :D

Cutting to the chase, I am leaving home for Rice University today although my flight is on the night of August 14th from Mumbai! Maybe because I spent my days getting a Bachelor degree as a Dayscholar, people seem to think i will have problems adjusting to my new life taking care of myself properly. I have my doubts, and my stint at IISc all alone earned that argument some brownie points. Nevertheless, I need to call up loads of guys and I have about 6 hours for the train so I will have to make this quick!

I dont hesitate a moment to admit I will miss this place I call home:-

I will miss the surroundings and I will miss my family. I will miss talking to my friends through phone (Hurray for the internet!) and I will surely miss the monsoon here:-

I will miss having not to worry about paying the bills or cooking food and I will miss being able to sloth 24x7 if I wish to: End of list!

Many a people shall be expecting a sentimental post here but that was as senti as I can get: I suppose I am making up now for being a cry-baby in my early years but I rarely get emotional so dont blame me. All I can say is I am not nervous, I am not excited and though it may just be the calm before the storm and I will find out for sure the moment I step onto the Runway, I am looking forward to this next chapter of my life. Might as well take it positively for no one forced me to take it up: I gave up a ~8 LPA job for this hehe..

To all my friends and family: Thanks for all the wishes and blessings, please stay in touch. I doubt I will get a chance to update this blog until I am well settled into my apartment with my apartment mate, John Connelly, who happens to be a 2nd year MS (Statistics) student and arrives Aug 22nd making me King of the Manor, ie, Apartment 139 for a week.

My flight leaves Indian shores on the eve of Independence day and coupled with Swine Flu fever (In more ways than one!), there will be some tight security at the airport. If all goes well, I shall arrive at Newark Airport, New Jersey at 5:30 am US eastern time and arrive at Houston at 11:30 am. A senior, Chinmay Hegde, is due to pick me up there to take me to Rice. So until next time, wish me luck and I will see you all soon.

Funny how from places I have no friends in, there are guys online right now reading this post: Shows the power of google and key-words I guess..

Arati also leaves tonight, and arrives in Michigan tomorrow evening. Hope she has a great journey but right now the only words I want to hear are:-

Ladies and Gentlemen, this is your captain speaking! We will be landing soon at George Bush International Airport, I hope you have a pleasant stay in Houston...

Going, Going, Gone!

4 Year Anniversary of NITK: Part 2

2009-08-10T06:13:00.001+05:30

August 2^nd 2009, 7:55 am in ATB Drawing hall 3-A which was converted into a classroom for Civil and Mining students, saw Darshan, Manoj, Shiva and I take our first class. I remember it was Dr A.C Hegde from the Department of Chemistry talk – No, whisper – to us about being ready to face criticism from many a faculty and fellow student who look down on us as the prodigal section of the college. But my mind was on the branch sliding process to be held in 3 days time on August 5^th and that day saw me getting into Chemical Engineering, a move that shaped my entire life. I also noticed a group of people in the ATB seminar hall, where this was going on, just having a lot of fun while everyone else was pretty tense. I later learnt them to be the DASA students, and prominent among them were two behemoths: Govind and Tariq! While one joined me in Chemical and became a very close friend/fellow mischief-maker, the other: Well those who know shall know!

As the day ended 30 students became part of the 1^st year Chemical engineering section:- Aditya Pai, Alok, Arvind, Christina, Debananda, Deepti, Dipankar, Govind, Hardik, Hitesh Sharma, Indu, Jayanth, Kiran, Manoj, Shiva, Nitin, Prabha, Prajwal N. Bhat, Preet, Rajesh, Ravi, Rohit, Sachin, Sourabh, Sourav, Sindhu, Suhas, Swapna, Varun and Yuvaraj.

The second round of sliding held on August 18^th brought newer faces and assigned roll numbers after Yuvaraj’s 05CH30: Arati, Arun, Manish, Nikhil, Sandeep and Sanjay while 2 left us for Mechanical engineering: Aditya Pai and Prajwal, leaving 05CH01 to receive a customary “Branch slide, Sir!” during attendance rolls. Of course by this time we hadn’t yet been taught the fine art of Proxy’s and the only weapon in our pathetic arsenal was the elusive Mass-Bunk which I believe our class has the dubious record of being the only one to never orchestrate a successful one ever. In fact one trial ended up so bad that we left the ATB hall from one exit only to enter it via another entrance some 25 seconds later upon sight of the faculty concerned!

It was the dreaded Chemistry cycle of courses first up for us and we had bitter experiences a lot…

Rakhi ka Tyohaar

2009-08-06T07:03:00.005+05:30

No, its not Rakhi Sawanth :-{

Maybe its because I am leaving Indian shores very soon that I got as many as 18 Rakhee's yesterday and more to arrive via mail today! My all-time record was 24- Count it- 24 in my last year in school at KV, Panambur and that too it was a half day for me.. Needless to say I am "Big Brother" material- Or is it that I am not suiter material??

The thing which erks me most is that even now, guys of my age take it an insult to get a rakhee from a girl who is not an immediate relative, no limits of frustration will take that out! But its not like I condone this "celebration" or anything, I actually dont care for all these Day's (Mother's day, Rakshabandan, Father's Day blah blah): If you care about someone, then show it the entire year around..

I had dinner at a cousin's place the last night (I seem to be out more often than not, and the paunch is evidence) and she showed gleefully the gold ear-rings her younger brother had got her: She is 23, the bro is 21; but the fact remains she was expecting something similar from me. How was I to tell I had spent rs 1.45 lakh the very day for foriegn currency and I had nothing better than a dress-piece? Seems that is as fine as jewellery these days given the squeal of delight she showed. Relief!

Nonetheless, I would rather share my respect for sisters/ mom/ dad etc the whole year round and God forbid the day arrive that I have to dread Valentine's Day! Brrrr...

The Church of Google

2009-08-04T07:33:00.005+05:30

I should have realised when Microsoft and Yahoo! joined hands in a partnership to take down Google (Keep trying, sucka's), something like this would happen. Anyway a friend asked me about 2 hours ago my opinion on a new religion: Googlism...

After the initial sarcasm I went to the official site and though its just for fun, believe it or not Googlism is now a recorded religion with its own church even! Check it out here, and feel free to join. It has apart from the church, its set of commandments and 9 proofs of Google being the closest thing to God :-)

It was only time that prevented videos like this being up on the WWW:-

On a side note, Prabha and Deepti leave Indian shores for the first time and I wish them a safe/hassle-free journey!

Rise of the Machines

2009-08-04T06:48:00.003+05:30

Now last night (5 am is still night for most of my pals), I was browsing through my favourite entertainment website Cracked when I read something which was too good to not mention here. Now everything there is worth publishing but its way better if you head over there and get lost browsing through the website yourself. Anyway...

The article 5 Superpowers Science will give us in our Lifetime had at No.5 the Iron Man's Battle suit which is being developed in Japan at the HAL 5 suit. HAL stands for Hybrid Assistive Limb but who cares what it stands for when you look like this and have 5 times a normal human's strength:-

Needless to say I was impressed because its something I was contemplating having since the Kodachaadri Debacle and this is actually in our times right now. But wait: It takes a remarkable turn for the worse. If this artificial suit was not strong enough, there are thoughts of including AI as a backup for the aged/physically challenged in times of emergency- Or so they would have us believe!

Just check out the name of the Company behind the suits.. Go on, click on the Official HAL Website and be amazed. Saw it?? Its bloody #$^@$^#&# CYBERDYNE! The company that makes the Terminators remember? Dont let the language fool you though, this is just a humorous article but I would still love to see what happens with this company in April 2011 (Judgement Day as per the Terminator Franchise) and ya, Cracked has this note regarding it:-

"Don't get us wrong, we're not saying this isn't an amazing technology. All we're saying is that you should find your nearest John Conner and sequester him in your local underground robot apocalypse bunker before some dip-shit scientist puts some kind of thinking chip in these things."

I dont blame them for posting this pic, its way too funny:

Did I mention that the HAL suit is now available in the commercial market in Japan for a hefty rent of 220,000 yen? Buy hey: How many of you can lift 200 kg by yourself?

Rakhi's House of Horrors ends :D

2009-08-04T06:34:00.003+05:30

Finally the madness has ended: But not before it claimed so many victims that it got a section on the news channels last seen when every single news channel (Including NDTV 24x7.. Sigh) covered the Abhishek-Ash marriage live for the whole bloody day!

The botoxed, buxom, controversial (Oh I can go on and on here) wench known as Rakhi Sawanth finally finished her charade and in the end picked for herself an NRI groom (Old habits die hard for Indians, and she must have thought Canada was a self-respecting, non-recession affected nation :P)

The entire nation went berserk on the internet, right from Twitter to Facebook/Orkut/Gtalk status messages and yes- comics too courtesy of my fav Indian comic FYF:-

Now I suppose I can go on about the Twitter wars but Abhishek has written a great piece and I cant aim to do much better than that so read it here and just for fun, here is a very funny article on the very topic. But wait: there were actually people who liked it! They liked it so much they want another Season of the show Lol.. Like the guys who made this You tube channel where you can watch all you want/can handle of the wench! Hope you survive the madness long enough to return here sooner than later...

4 Year Anniversary of NITK: Part 1

2009-08-01T06:06:00.000+05:30

Can’t believe its 4 long years already! Why it seems just yesterday that I entered the hallowed halls of NITK as a student for the first time. In fact it was 4 years to the day that this happened, and I remember it: A most cherished set of memories…

I remember walking into ATB (Additional Teaching Block) class 0.2 at 7:40 am on August 1^st, 2005 with my dad. I remember taking a set of forms and notices from Mr Manohar Karanth, The Watch & Ward officer, and filling them diligently with my dad going through them 3 times atleast! I remember then going into the ATB seminar hall, and immediately getting intimated by the amount of people and all the “important officials” there. I remember handing over the forms along with original mark sheets of Class 10, 12 and AIEEE with a DD for the 1^st semester fees and deposits. I remember shaking hands with the then Registrar Dr Aloysius Henry Sequeira and taking the receipts for them all before meeting an old Zen gym acquaintance who turned out to be working at the Student Cooperative Society. I also remember…

I got lost on the way to SJA (Silver Jubilee Auditorium) and was directed there by a guard whom I know to this day. I met my mom and old school mates Darshan and Manoj who were also admitted into NITK. We waited patiently till 11 am when the inauguration of the academic year finally began and diligently listening to all the long speeches which at this time make me laugh at the very notion. Following this was an orientation trip of our assigned department which at the time for me was the Department of Civil engineering. And so it was that all 3 of us along with some 40 more trudged along grudgingly in the afternoon heat which saw every outsider pouring sweat but we were taking it as a nice break from the rain J

Mr Dwarakish gave a most brilliant trip of the Department of Civil engineering and it was here that I saw Arati chatting to NTR and a few other “bangys” as the term goes. Of course back then I was shy of looking at girls, let alone talk to them: My, how things have changed hehe… But I knew that I was surely getting a branch change soon and so faked a head-ache to get out of the procedure after 1.5 hours much to everyone’s jealousy (I was, and still am, a pretty good actor) and came back home at 4:30 pm to finish my first official day as an NITKian.

SNIST experience Part 3

2009-07-30T07:24:00.006+05:30

I still remember the time:- 12:50 am on 2^nd July, 2009 and a knock on the door which in retrospect felt like a buzz in my sleep. A second, louder knock and I was up (Son of forest sleep with one eye open- Old Jungle Saying J) and awake. But getting Sandeep aware enough to open the door took some time and as I sat on the bed in marched 3 POLICE OFFICIALS. One of them was a rank 3 Inspector and he asked us if we knew Hindi/Telugu. Sandeep looked like he was in a coma as he reclined against the far wall and knowing his sleeping habits, he probably was! I then had the once-in-a-lifetime experience of having a most unexpected interrogation by the police as they asked as many as 9 questions including a hilarious Koi Ladki ya Bomb kamre mein hai kya? (Any girl/Bomb in the room?) Clearly they took no chances and I found a new respect for these men in Khakhi. After they seemed satisfied of our innocence they left but not before we snuck a peek out the door long enough to notice simultaneous raids had taken place in all the rooms. It was impossible getting back to sleep – well for me atleast – and when the sun shone out at 5 am I was there to give it company.

Room service later (Lazy bums FTW!) the same procedure of getting to Uppal for the bus ensued but we found instead of Dr Rao, his fellow department faculty who took advantage of us and for the next 1 hour talked on his views about not allowing Abstracts to be the basis for selection of scientific papers to the extent that he had filed a High Court case on the matter! Extreme measures but the talk was interesting.

Now after last afternoon showed us the level of presentations to be expected, we had agreed to leave at 2 pm citing my journey back home as an excuse. The morning saw more guest lectures including one by an alumni of Dept of Chemical Engineering, NITK and then we were about to take out leave from SNIST as Dr Rao came to bid us farewell and presented to us our certificates:

The poor man had taken trouble to get those ready in time for us and if that was not enough, he than arranged for an exclusive SNIST mini-van (Which not even the Profs get to travel in) to drop us to the nearest bus-stop but not before we took the customary pictures with the college as the background:-

Now we were at the bus-stop but sight of a 7-seater brought memories as we chose to go through the whole ordeal again only to see if our old record of 13 people could be bettered. And so it was: with a maximum of 16 people on board at a point, it was all we could talk about for the next 20 mins as we got down in front of our hotel and went straight to a nearby restaurant to have our fill of Hyderabadi Biriyani – We were not letting Hyd get the better of us here! With prior experience in mind, a smacking lunch ensued we weren’t leaving the city disappointed and the afternoon was made all the better by the timely arrival of another friend, Rahul Nesergi, who gave us company and news of many a NITK acquaintance:-

Finally it was time to leave Hyd – One last time before I leave for the USA, and to say I had a great time would be an understatement…

SNIST experience Part 2

2009-07-29T06:11:00.015+05:30

Room service was made specifically for lazy bums like us! A quick meal aside (remnants of the biriyani still haunted us), we soon learned the auto drivers of Hyderabad are a much more honest folk than those in Mangalore/Bangalore. We had to take a college bus from SNIST at a place called Uppal which was about 7.5 Kms away from the lodge and it was there that we met Dr. Ramagopal Rao who was responsible for inviting us to participate at the conference and, as a friend of Mr Prasanna, promised to help us in every way possible despite being the coordinator of the entire conference.

From first glance, he seemed a good chap and by the end of the day we were jealous of the SNIST students to have such a good person among them as a professor even! The college itself is in Yamnampet, Ghatkesar- about 28 Kms from the main city and has great facilities. The entire Dept of Biotechnology is air conditioned and the building which houses this dept also houses the School of Management Studies and a certain room titled “English Lab” which has inside a horde of PC’s, LCD Monitors and a humongous 48” CRT TV.

The place itself was undergoing construction work for more facilities and it was interesting to see scaffolds a metre away from the classrooms. The simultaneous inaugurations of 3 workshops being held there began after registration and here we heard first hand from the main protagonists of this event: The Principal of SNIST, The HOD of Biotech dept and the Dean of research who turned out to be a most magnificent speaker:-

After all this we had a chance to finally see our conference paper in hard copy and it was a great delight to say the very least:-

In case you are wondering, VSS stands for Varun-Sachin-Sandeep and if the bacterium was only 4% off the standard strain we would have got the opportunity to name it after ourselves ourselves L

Anyway off we departed to the Electronics Dept Seminar hall which was the venue for our conference and a few guest lectures preceded a lunch after which our seminar was the very first presentation in the conference which went very well despite the computer not having the necessary codecs to play a movie file during the ppt itself! Once our official participation was over we settled down to watch the remaining presentations and soon found our stride as proper NITKians as we proceeded to find fault and make snide remarks of all the mistakes prevalent in the other works - among of course! The proceedings for the day ended at 4:45 pm and we took the same bus back to Uppal. However no bus was in sight and we decided to adventure a 7-seater…

The working mechanism of a 7-seater journey is you sit in a place meant for mice while the driver and his accomplice try to wriggle in more people heading the same way. Although there are supposed to be no more than 7 passengers, this particular trip saw a maximum of 13 people with the accomplice hanging on by fingertips as we sped across roads needing more attention than a village pathway. To say we were shaken up would be an understatement.

On the way back, after a total of ~1.5 hours of calls between us, Kiran, Rahul Nesergi and Swapna Bandi we finalised on meeting the Bandi sisters that evening at Prasad I Max and it was great meeting them after 3 months. The mall had its attractions and a trip through a so-called Hall of Mirrors turned out to more scary than the girls wanted:-

Me with Optimus Prime :P

All four of us in the Hall of Mirrors

The look down the mall from 2nd floor

Interesting Name for a Pastry

We had to leave early after dinner at Mcdonald’s since my uncle and aunt from Secunderabad were coming over to our room to meet us while getting “goodies” to take back. After they left at about 10:15 pm and a quick game of DOTA later, we retired for what we hoped would be a peaceful night’s sleep: We were so wrong…

Much ado about nothing!

2009-07-23T10:54:00.001+05:30

Lots of hype was created for the "Total Solar Eclipse" which was also the longest in some time. I knew better than the well-intentional albeit stupid promotional scheme run at the local observatory to have people watch the eclipse for free: This is the middle of the monsoon season and we are in a place that gets 4+ metres of rainfall each season! So instead of being able to see something like this:-

All that was visible here was a lot closer to this:-

Anyway watching the live feed from 3 different internet sources made up until the news from Gulbarga, Karnataka arrived where kids with ailments were buried sometimes upto their necks and then exposed to the eclipse for "treatment"! Its too harsh a sight to post any pics here but you can imagine the situation. This was almost as bad as the recent honour killing in Haryana and the politicians advocating it as "personal views" to save their legislative seats in the upcoming elections there..

Such things I shall not miss when I am in the USA, but what Continental Airlines (My flight carrier) did to Dr APJ Abdul Kalam was astounding! The airline staff argue that Dr Kalam never once informed them about his VVIP status and permitted himself to be frisked - Which is very typical of him might I add - but all the show started when his escorts saw this and created an uproar. I dont blame the airlines for frisking anyone who didnt inform them of his/her privilege and its just one of the recent controversies in parliament; the other being the Indian version of the show "Moment of Truth".

To close off, my classmate Manoj has created his blog which is really a fledgeling right now here

Heights of Recession!

2009-07-15T06:43:00.002+05:30

Sreesha Y Rao, the college topper of NITK surathkal (Ranked 3rd in placements in India) who has an SGPA of 10.0 on a scale of 10 and a CGPA of 9.8+ is unemployed! Stupid Alstom has no idea what they are missing...

SNIST experience Part 1

2009-07-04T08:39:00.008+05:30

When my major project guide, Mr Prasanna, suggested I present my project results at a National Biotech Conference at Sri Nidhi Institute of Science & Technology, Hyderabad, little did I know this trip was going to be a bang in more ways than one! For starters, it would be the first time I would be on “business” for myself and I also got an excuse to meet some of the guys in Hyderabad. Sadly Sachin didn’t get permission from BPCL to join me but Sandeep certainly was enthusiastic about the entire thing…

So here I was on the evening of 29-0-2009 in the KSRTC Airavat bus bound for Hyderabad and I found myself watching a Telugu movie with no idea whatsoever about the dialogues but could grasp enough to see it was a pretty good movie.

The morning of 30-06-2009 at 8:22 AM and I was in the Mahatma Gandhi Bus Station (M.G.B.S) terminal which, as I certainly found out to my chagrin, is the biggest bus station in all of Asia. Sandeep was no different than the last time I saw him (Just 2 months ago) and we checked into the nearby Nandhini Lodge.

If you have been to Hyderabad before then you realise why as a non-vegetarian we crave for their Kebabs and Biriyani and this was on our minds for the past week. Sadly the two most popular biriyani joints (Bawaarchi and Paradise) were too far away from were we resided so we took a chance and went to the Char-Minar area hoping to get a taste of authentic muslim chicken biriyani. It took about 30 mins to get away from the maze of jewellery shops all around but finally we decided to take a risk on a Hotel Shama (which we later learnt was famous for its Irani Chai) and went in…

The décor was pathetic but the food- Only here did we realise that the quantity contemplates the quality of the biriyani as we each ordered 1 plate each to realise its actually a mountain full. After 45 mins and various rest stops with nothing but our egos making us continue, two muslims gave us company in front of us and took great delight in announcing that the local women could have a plate each while the men had a few rotis before having a plate each. With our egos totally destroyed, one of them took the liberty of “advising” us in Kannada no less to just stop and leave it which we gladly did.

We planned to walk back the entire way (5+ Kms) and decided to explore what looked like an old palace which turned out to be the Osmania General Hospital!

After 30 mins of sitting and groaning, we came back to the room and slept our asses off for a few hours before rehearsing for the presentation the following day and, after a few Russell Peter joke segments, retired for the night: The biriyani was omnipresent still now L

Day of huge proportions

2009-06-26T12:25:00.003+05:30

Micheal Jackson is DEAD :) No, dont get me wrong- I never really liked his music and I am glad he has stopped his child molesting activities (That includes dangling his own kids from the balcony)... To whosoever writes back about this: Good for you, this is my opinion and my blog so FU! More than 80% of the "sympathizers" are mere hypocrates. If the world can tolerate really sad jokes made at the expense of Elvis "The King" Prestley himself (Him dying on the commode seat), how long will it take for jokes to start arriving here? Not very long:-

And if you thought that was not funny you need to watch CSI:Miami a lot more! Oh ya the rumours on MJ being still alive are here and while he is dead as far as I am concerned, I still wonder why the world conveniently chose to forget that he had changed his religion to Islam and his name to Mikaeel? Dont get me started on racism here...

Visa Experience Part 3

2009-06-26T07:13:00.017+05:30

The time was 7:10 AM on 22-06-2009, and I was well ahead of the reporting time of 7:30 AM. Just as I was about to think it was just me, I realised there were 4 other people around me who had come early too. Here I wish to bring about a most peculiar aspect of human beings- In professional surroundings, they tend to have a conversation revolving totally around the current atmosphere and it’s immaterial that they don’t even know each other’s names. Similar was the case here and in the entire time I spent with these people, I can claim only to know the name of 1 and that too because I happened to glance at his Visa interview appointment letter: Jason Jesse James (JJJ, that’s a killer name!) from Kerala who happened to have an MS admit from Georgia Tech. The other 2 guys were from Chennai and were going to University of Illinois for an MS course. The gal behind me was going to Rice (I certainly had my share of lady company during this trip) for an MS course and it was obvious I talked to her more due to the fact that we had the same destination in the US of A.

At 7:20, we were allowed a free pass ahead of the crowd by a security guard with a most astounding moustache- The thing seemed to cover half his face! Thick tamil accent not withstanding, he had all of us hand over the passport and appointment letter to him through a window sill and then returned them all to us. The gate opened and for some reason images of Fox River Penitentiary (Prison Break FTW) came to my mind with the appropriate music. A series of security checks followed and the guys were separated from the gals for obvious reasons. Now I wont pretend I liked this, but I turned out to have a great time with Jason and the other guys for the entire 1.5 hours that I was inside. The guards inside suddenly seemed to have a much calmer demeanour and a voice that would put Baba Amte to shame despite being more Madraasi than Rajnikanth himself! Security checks over, we walked through a very heavy metal door into air-conditioning- Oh thank God for that…

Yes, someone actually made this image for the internet!

There seemed to be people of all possible regions of India here and I don’t envy the coordinators who had to handle them all. Mind you, we were still in the Indian section and sadly it was unanimous among the 4 of us that the Indian inspectors were clearly ruder than their American counterparts L…One of them was a grumpy old man (GOM; Nothing to do with the media player) saw me as he attempted to rectify my documents and in the midst of it asked me to write my name in Konkani on one of the forms despite it being clearly written that Konkani had no written script. Then the doofus asked me to write it in tulu, kannada and Hindi in that order. Finally his role was done with and I was asked to take a well marked path to another building where the US consulate-general along with his people worked. Here was where the actual visa interview would be:-

Inside, after crossing multiple security checks and those heavy doors, was a huge hall divided into 2 sections: One for the dependents of those coming along with the primary applicant and another for student/exchange visitors. All 4 of us, who were still together, took a gamble and sat at the far left of the waiting hall- Now this was mainly because the LCD TV set hanging directly above us was showing highlights of the ICC T20 world cup final but there were very few people here and the majority were in the right hand section of the hall. A lot of talking ensued which mostly revolved around the application process, including one of us who was forced to give his TOEFL in a Reliance webworld with 35 people all talking at the same time and another who had pressed Cancel on his GRE score window by mistake when he was confident of securing a 1600!

The visa interview counters soon opened and there were 3 people available: Another grumpy old man (GOM), a sweet matron lady and a unanimously declared hot latin chick (HLC). GOM & HLC seemed to handle the students and in the 20 minutes we waited, GOM interviewed just 5 students and rejected 3 of them with 1 girl bursting into tears right there at the counter while HLC accepted 8 of the 11 applicants at her counter with a smile: It was clear where we wanted to go but ultimately it was not our choice. However sitting in the far left paid off big time as we were asked to stand in the snake-way very soon. When I was the next to go to an available counter, the person in front went to HLC and I was cursing my luck. Luckily GOM decided to be extra special in his own way with the guy he was interviewing and by the time he was done, all 4 of us were finished with HLC…

HLC: What are you going to do at Rice?

Me: Pursue my Doctoral Studies, Madam

HLC: In which field?

Me: Inorganic catalysis (Quite clever if I do say so myself, its probably the most harmless chemical topic there is)

HLC: What’s that?

Me (With my mastery of peshaab): Study the effect of imbedding metals and metal compounds into carbon or silicon based catalysts to get a higher surface area-to-volume ratio (For the 3 people in the world who know my fascination with the “surface area to volume” term, it’s now less… A lot less!)

HLC: Uhmm… Ok! What are your parents?

Me (Highly tempted to reply Homo sapiens): My father is a banker with Bank of Baroda, and my mother is a home-maker

HLC: And how are you sponsoring your studies at Rice?

Me: I have a full fellowship from Rice University

HLC (Gives a hard look which for some reason got the other guys there jealous J): Ok study well at Rice

Me: Thank you, Madam!

And that was it: Less than 30 secs for a process spanning 2 weeks of work and a further 2 weeks of waiting! Coming out the fortress took a mere 15 secs owing to no checks or obstacles, there was another door there and voila- I was out at the gate! Waited a little for the other 3 guys, shook hands while congratulating each other and we went our separate ways…

The train journey back was routine and I am thankful for that- I didn’t think I wanted anymore to do with loud girls/babies. I bought 2 novels and 10 DVD’s from a seedy looking guy (Aren’t they all seedy??) and at 10 AM, 23-06-2009 I was back home. I got my passport soon afterwards and that was the end of the Visa experience, for now atleast…

Visa Experience Part 2

2009-06-25T05:43:00.019+05:30

This post is dedicated mainly to Yuvi-Macha and Prabha-Kutty who tried their best over the last 4 years to convince us of the beauty of Chennai: Ya right! Anyway…

As the train ceased its motion finally, I realised why they say you can tell Chennai is not far off from the smell! But to be fair the stench emanating from most central stations is not that of Aphrodite in her hall of flowers. I got down:

and without questioning why, just followed the masses to the main entrance hall: It was my first impression of Chennai proper in over 10 years and to say it was chaotic would be an understatement. The human scent was everywhere and sounds of “Thambi!” and “Macha!” showed the brotherhood of the common Madraasi.

Getting off the station, I crossed the road and a heat wave hit me full on! Mind you that I had just spent over 18 hours at 20⁰ C but it was 3 PM and the temperature must have been atleast 40⁰ C. Alas that it was much later I learnt the secret of survival here: You need to keep moving- If you stick in one place then you will melt, but the relatively less humidity (wrt Mangalore) keeps away the heat upon constant movement.

The rickshaw guys didn’t help make things better for this poor visitor as they asked for anything between Rs 150 to Rs 400 (No, I am not joking!) for a 7 Km journey. About 30 mins (and over 500 buses later), I got the proper bus and it charged me Rs 3.50 (Lol) for the very journey!

The roads in Chennai are bifurcated, and each bifurcation is then bifurcated too in the sense that it’s a 2 lane road made into 2 mini lanes each for up-down movement. The city par-se is actually clean but then the open drains next to nearly every bus stop doesn’t help raise the city’s prestige in the alien’s eyes.

My destination was a cool little lodge with air-conditioning (The only thing I cared about!) and settled down soon in front of the TV to watch the women’s ICC T20 world cup finale.

In the late evening my dad decided to go out “for a walk” or so he told me and asked me to join him. Too late I realised it was just an excuse to visit Saravana Selvarathnam: The Shopping Mall FROM HELL!!! Over 6 stories of garments and nothing else stood in front of me and everywhere there seemed to be a picture of a ridiculously happy (and ugly) man who probably owned the whole thing… Did I ever mention I hate shopping for ordinary stuff like clothes? Take me to Chor Bazaar and you will find it near impossible to drag me out but this can go to the Birds!!

Things were looking routine until I developed a case of loose motion - That Chicken Biriyani was a little bit too funny I guess! Now this is probably the worst thing that could have happened to me given that the consulate people look for any sign of weakness you present there, but luckily I healed in time with the help of medication. The next day saw me in formals and carrying a file looking like an IT coolie, took an auto and got down in front of the VFS centre because the auto driver thought it was the US Consulate. Luckily the consulate was only a minute of walking away and I turned the corner, only to see a mass of humanity- trying their best to be part of the Indian exodus into the US of A. This place is a white fortress and there seemed to be people everywhere…

Tetris with Lyrics

2009-06-25T05:36:00.006+05:30

Courtesy of You-tube and a certain Malaysian friend, this video is one of the funniest I have ever heard. For the benefit of, well, everyone I got the lyrics below: Hear it and tell me you didnt like it- I dare you! It has 18+ wording content though...

One, two, one two three four
Shapes made of four colored blocks like a T or a box
Come down like falling bricks
You can place them in rows, but everybody knows
That they made this game for chicks (HEY!)

Mom just loves to flip and stack
Grandma says this shit is like crack! (Well it is!)

This is the game girls deserve, there is no learning curve
Which makes it great for noobs
It will fill you with glee, especially if you have a vaj and boobs (HEY!)

Your mom loves it
Mine does too
Call me sexist, bitch it's still true (just kidding about the bitch part)

Deep in a girl's dainty brain, there's a spot near a vein
Which regulates their bliss (The T-spot)
Once they see falling blocks, the T-spot unlocks
And they start to sing like this (SING!)

LA LA LA LA LA LA LA
WE LOVE TETRIS, LA LA LA LA

Here is a trick I have learned
To avoid getting burned
When you piss off your chick

If you sing this on key,
Immediately she'll forget that you're a dick (Try it!)

LA LA LA LA (I'm still mad.) LA LA LA (Is that the Tetris song?)
LA LA LA LA (I love tetris!) LA LA LA (Im happy now.)

Tetris helps when chicks want to neuter us (Snip, snip, snip)
If you love it, you probably have a uterus!

The misadventures of last night's get-together

2009-06-24T06:02:00.013+05:30

When a friend of 16 years, Darshan, revealed he was all set to join Indian Oil Corporation Ltd (IOCL) in New Delhi from the 28th of June I knew it was the end of what I believed to be an extended run at closure from NITK for a lot of my classmates: 5 dayscholars, 1 in college till July and a few who keep visiting made it feel like college never ended-Yet!

Enter Preet Joseph Joy who after spending what seemed like an eternity at Sreekumar Sir's farm at Karkala was beginning to look a lot like him:-

Preet normally

Preet Now

He was returning to college to bid farewell to the faculty and it seemed perfect that I had returned from Chennai an hour ago! Plans were made to meet for dinner at Chef's, Kadri for 7 pm and all around promised to be there. The weather was great and sunny and I made the huge mistake of not taking along an umbrella which, as it turned out, made this evening unforgettable even before we met at all...

I have a confession to make- I am ridiculously punctual; to the point where I arrive 15-20 mins earlier than the expected time even though I am fully aware others arrive 15-20 mins later. Similar was the case yesterday when I arrived at Chef's at 6:45 pm where the others (The earliest group atleast) was a good 40 mins behind. The weather was still breezy and clear so I decided to go "exploring" and went along a side road which I had not before traversed. Seeing that I had atleast 30 mins on me, I kept walking till I realised I was about 4 Km away now and night was falling quickly. All this was no problem until the first drops of rain started coming down on me, and I turned back only to spot a sideroad which "could" be a short-cut...

I have another confession to make- Even when I know the direct path will surely lead me to my destination, I will take chances on possible shortcuts to the destination if only to get it into my memory bank of maps and routes! Similar was the case yesterday and I took a road which led me to a small tea-shop by the side of the road when the heavens poured down- literally!

The rain was so bad that when I decided to chance it, I had to scurry back running and the "gud-angadi" man gave me a cup of his finest coffee for free (I had offered to pay!) and maybe due to the given circumstances it was the most delicious coffee I can remember having. The rain stopped briefly and I hurried back. I was but 200 metres away when rain struck again and this time I had to make do under a few banana leaves near the edge of a 50 foot fall off the road

straight onto the roof of a shop and so I waited, getting soaking wet nonetheless. In about 15 mins (the time was 7:25 pm) I was able to reach Chef's where the doorman had second thoughts about letting me in unless I dried myseld off!

Anyway everyone soon arrived and the party was great, especially knowing that I was probably seeing most of them (Preet, Manoj, Kiran) for the last time and the rest had few days left themselves- Suddenly August was not that far off!

Sanjay & Darshan

Manoj, Preet & Kiran

Manoj, Kiran, Me (via Mirror), Sanjay, Darshan, Shiva and Preet

Shiva, Me, Darshan & Sanjay

Great evening, capped by the memories! Thanks guys..

Visa Experience Part 1

2009-06-23T12:19:00.002+05:30

“Just look into the eyes of the person, be confident and don’t be nervous!”

Such words and others (Many, many others) were the cause of tension for me the last week as I attempted to get my Visa for the doctoral studies I would soon pursue at Rice University. Of course I was as cool as cucumber till news came of Sameer Rao getting his name on the Visa wait-list and not the instant approval: Despite the external differences, both him and I are smooth talkers- Our mouths are probably our greatest strengths and in this case our greatest weakness.. Talking incessantly was not good here- not good at all…

Forgive me for making this sound like something out of a suspense novel! I can’t help write such for my mind thinks in a way that makes even the most routine of jobs seem equivalent to building a skyscraper all the way to the moon... But before I get ahead of myself I need to go back in time: Back to Thursday, 18-06-2009 and the time was 5:25 am. I was talking to my senior at Rice, Sravani, who told me all it took was the I-20 form which said I was funding myself through a fellowship and the Visa would be mine. Well Sam had a superb GATech admit with a full fellowship too, and as far as sensitive topics go- Nothing is more sensitive than a Chemical Engineer attempting to study Nanobiotechnology (Read Michael Crichton’s Prey for more).

I took advice from many corners, some human, others from the internet. But there I was at 9:30 pm on Saturday, 20-06-2009 sitting in my train seat waiting for the train to depart from Mangalore Central railway station on its way to Chennai Central. Within 5 minutes though, everything changed…

No- Robbers did not attempt a burglary, there was no terrorist attack and neither was a couple fighting through its marriage with the bride attempting to jump off the moving train (The one who this happened to, knows it and I need not mention the name here!) but something far more uncomfortable for me, atleast for now. I had seat 30 in the AC 3 Tier coach and the 5 closest seats to mine got occupied by a group of college girls who I soon learnt were on their way to Salem for a trip. Now those who know me will have giggles by now and as I attempted to make light humour of this situation by informing some friends, the responses ranged from “Oh ya great dud… very lucky… Introduce ur self to them and give ma number ok…… ;-)” and “Oh wow.. J why don’t such things happen to me man… L” to “How fortunate you must b! Take advantage of the situation, my dear friend 4 such golden opportunities rarely knock twice. ;-) lol. Enjoy.” The only “enjoyment” I had for an hour or so in the beginning was listening to some splendid, and utterly nonsensical, express Malayalam with the words “Kankanadi” and “Parotha-Meen” coming in nearly every sentence for some reason..

People fail to realise I have already had my share of good luck for the entire summer and it was bound to run out. So it indeed did: I wake up in the morning to find them replaced by a family with not 1 but 2 wailing kids! Ok so maybe I woke up a lil late given that I slept a lil late (Ahem!) but nothing was to stop the infants that day… I was willing to tolerate it if it weren’t for the adults accompanying them who seemed to have a penchant for making conversation with the babies…

I ask you- Why is it that a perfectly functioning human adult lowers his/her IQ by a 100 points when in front of a cute (And awake) baby? The multiple sounds of “Gilli, gilli” and “Baa baa” resonated throughout the compartment for the better part of the morning and retiring to my top berth was no help as they put on the fan at high speed (I was right underneath the AC shaft). Lunch soon arrived and the Chicken Biriyani tasted a bit funny- little was I to know that it was not going to be funny for long…

The time was 2:50 pm on Sunday, 21-06-2009 and the ingeniously placed announcement board in the compartment announced Chennai central was a minute away. I gathered my luggage and got down, following the crowd into Chennai- A place I haven’t been to in over 7 years and all the times it has been mentioned, it has been with a shudder: People do NOT want to go there, and I was about to find out exactly why…

Rice ID

2009-06-20T07:14:00.004+05:30

Rice University finally sent me my official email id: Varun.Shenoy.Gangoli@Rice.edu or Vg4@Rice.edu

But what made that letter funny was that it was addressed to Varun Shenoy in Iran and they actually sent it to Iran before figuring out that Karnataka is in India! I was lucky those Iranians didnt confiscate the document as a state secret but hey- How many people get a letter that has Iran scratched and India written in a child's hand writing with apologies on the cover??

Pseudomonas fulva????

2009-06-19T06:41:00.008+05:30

The National Centre for Cellular Sciences (NCCS), Pune finally released the genotypic identification results of my bacteria 2 days ago and to say it was surprising would be an understatement! While all of us were expecting it to belong to the genus Lampropedia (Which was my find from the huge Bacteriology manual btw), the result gave it a 99% match to Pseudomonas fulva- A pretty new species given that no one around had any clue about it. For those who are interested, here is the genetic composition of the bacterium:-

GCGGTCACTTAATCGCGTTAGCTGCGCCACTAAAATCTCAAGGATTCCAACGGCTAG

TTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGC

TTTCGCACCTCAGTGTCAGTATCAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCT

TCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCGTACTC

TAGCTTGCCAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGCTTTCACATCCAA

CTTAACAAACCACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACC

CTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTATTCTGTCGGTAA

CGTCAAAATTGCAAAGTATTAATCTACAGCCCTTCCTCCCAACTTAAAGTGCTTTAC

AATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTG

TCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGT

GTGACTGATCATCCTCTCAGACCAGTTACGGATCGTCGCCTTGGTGAGCCATTACC

TCACCAACTAGCTAATCCGACCTAGGCTCATCTGATAGCGCAAGGCCCGAAGGTCC

CCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCGTTCCTTTCGAAACGTTGTCC

CCCACTACCAGGCAGATTCCTAGGCATTACTCACCCGTCCGCCGCTGAATCAAGGAG

CAAGCTCCCGTCATCCGCTCGACTTGCATGTGTTAGCCTGCCGCCAGCGTCAATCTG

Even mightygoogle has no useful info on this but I suppose its clear now that I got pics to compare:-

Pseudomonas literature Picture

My bacterium observed under Microscope

While that may sound gibberish, it was big enough to warrant an application to present this work at the National Conference on Biotechnology to be held on 1^st and 2^nd of July this year in Hyderabad. More on that if selected to appear!

The Broken Jinx

2009-06-15T06:13:00.002+05:30

This post is wholly dedicated for my friend Manoj Krishna, who broke a most elusive jinx this past week. Apart from the multiple treats at restaurants, its pretty evident he is one happy person now.

Beginning in early July, 2009 he sought to get placed in a reputed, if not high paying, company through the placement cell of our college and lets just say things never worked out for him! He sat through the placement procedure of nearly every company and all he got was the rejects at various points of the procedure:-

Aptitude test rejects

TCS
Hewlett Packard
Dr Reddy Labs
HSBC Bank

Group Discussion

Accenture
Coca Cola
Jindal Steel

Personal Interview

I-Gate
Globallogic
Patni
L&T
L&T Valdel
BPCL
Saipem
Engineers India Ltd
MRPL
ACC Cement

Finally he decided to give the GATE an attempt and it turned out to be the best decision he tool with an AIR of 125 in Chemical engineering. Oh but the jinx was not done yet...

Tried out for National University of Singapore but gave up in the middle due to several IIT interview calls. Then went to IIT Delhi, but failed to pass the interview. A most hideous turn of events when he was selected to do the M.S (Research) at IITB but later learnt it to be a non-degree, 1 year program with no career help from it! Then an interview at IISc which was botched up in the 1st place but got a further degradation due to Arati not mentioning to anyone in class about her admit at Michigan State University but the IISc interview panel knew it.

Finally he got a call from IIT Madras to do an MS program there, and after thorough checking into it- He accepted it!! Congrats Manoj, and hope you do very well there indeed (Still waiting for the second treat :P)

New Indian currency coins

2009-06-13T11:36:00.003+05:30

Finally got my hands on the new 5-rupee and 10-rupee coins issued very recently by the Reserve Bank of India. Now I am not a professional coin collector who gets mail-order catalogues but as an amateur I happen to think I am a pretty good one. So when my uncle happened to get a specimen of the new coins, I was pretty much ecstatic.

The new 5-rupee coin is of the same cast as those issued 3 years ago except lighter and has a golden finish:-

The new 10-rupee coin is bimetallic and has the now familiar cross symbol which supposedly means "Unity in Diversity" though I have no clue how it says that:-

So if anyone sees such coins in the near future, dont be surprised and just accept them!

A Fellow Blogger Arrives!

2009-06-12T11:19:00.004+05:30

Before I speak more, I urge you to visit the Incident 2009 website and notice that it was all made by a young chemical engineering student- Namely, Kiran Kumar- who happened to be my classmate and good friend the last 4 years. As a tech genuis, he is rivalled by few in this world for his age and he finally opened his personal website Kiran's Universe albeit with a tech blog (Some things never change!) and with a wordpress frame work even (I told him Blogger is better).. If you are a typical nerd/geek or just someone who has a technical problem just visit his site (No, I am not advertising- the site doesnt have any ads!) and have a good time.

Day of the Gentleman

2009-06-08T07:20:00.008+05:30

Without doubt, this Sunday was a sports mega bonanza with as many as 5 different sports being broad casted on television. And in all of them, players with class prevailed. Now I am not telling I am against guys with passion but I am always up for genius rather than playing for winning alone. For those who know me better, I am always for class in life: A Nokia N series phone, a HP DV9000 laptop, a Sony Bluetooth headset, Pioneer speakers, Bose headphones and when I get a car it will be a Mercedes or a Ferrari eventually! High standards? Class, people, class..

Without doubt the biggest winner last night was Roger Federer who got his grand slam championship (Finally!) and equaled Pete Sampras with the total number of grand slams (14) and for everyone who says it was only because Nadal wasn't there: He didn't even make it to the finals! 6-1, 7-6, 6-4 will be recorded in history for those 6 numbers brought a great player 1 step closer to being the greatest yet.. For the record, Soderling proved himself victorious against players who depend on routine, ie, the same style of play with devastating accuracy but Federer was all art with him back flicks which won him the title!

Speaking of class, Jacques Kallis and Abraham de Villiers personify class and they proved it in their match against the minnows Scotland last night. The ICC T-20 world cup has begun in full flow and its a treat to watch after the stupidity displayed by the same commentors during the IPL!

Then there was Formula 1- The Turkish GP- which was "buttoned" up by Jenson for Brawn GP. Winning 6 of the 7 races so far and missing only 4 of the max possible 65 points so far, he looks set to claim a maiden driver's championship this season- Oh and Lewis Hamilton is rotting in the back :)

The Day of Reckoning

2009-06-06T06:27:00.003+05:30

I will not be forgetting Friday, the 5th of June for some time. Quite a few things happened but clearly the biggest was my laptop crashing straight down to hell! Ya thats right, my Rs 85,000 juggernaut decided that since the warranty period was up it could now begin to give up on me.. It began just a week after the warranty ran out when the application on hand would suddenly hang and all I could do was remove the battery so as to force a shut-down (crude but effective), then came the "Sleep" problem where sleep no longer worked and the aforementioned solution took place. The last few weeks saw graphic issues with pink dots/lines on the display panel but a restart took care of it- till yesterday!

I was playing a great game of Dota, albeit with AI, when the screen blurred and the pink dots appeared. I knew Vista too had a blue screen of death and I finally saw it when it said there was a critical (That didnt sound good even for me) error with the display adapter and Boom- a magic restart only to have the screen come like a 1990's screensaver with waves of White and Black moving slowly! I swear I took this harder then the end of college last month as my days of joblessness were survived only with the help of my laptop and its 500 GB hard disk of data..

So I was on my way to the HP service centre when the person I bought it from calls and tells me to come to him as he can fix it himself in 10 mins.. Happily I changed buses and went about 2 Km walking on the course of which a thunderstorm gave me company but I was finally able to reach a dear friend by phone so I never noticed the rain! Anyway I reached the place and she (Yup, the "he" was currently unavailable and she was his wife) takes a look and tells me to go to the HP service centre itself.. The HORROR!!

An hour later (which included 20 mins of walking in sludge), I found myself in the service centre where the guy in charge tells me I got no warranty left - I know that, Sherlock! But then he gives a sly smile and speaks in Konkani (Does everyone in Mangalore speak my mother tongue?) and suggests that I get additional 2 year warranty for rs 6.5K rather than spend close to 20K on repairs- typical Konkani mind working faster than computer (You see, Chacha Choudary was also one of us!) and then the big bomb: Laptop will be out of action for 2-3 weeks minimum..

Then just as it was time to head back home a most vicious rain strikes and I am drenched fully waiting for the bus to arrive. I reach home at 1:15 pm only to learn my car driving class is at 2 pm, rushing through a lunch I arrive just in time but not enough luck was left for the day as the instructor proceeded to belt me twice for not ever touching the brake pedal & just decelerating for sudden turns..

Gym followed at 2:30 and after all the running around previously followed by a hard work-out I weigh myself to see I have GAINED a kilogram.. Incredibulous! But the day was still not done, for on the way back I took a different route and found myself close to a broken down building which I later remembered had this children's tale of being haunted.. I am gonna explore it soon but till then I have to find a way to exist using my lame old pc which I neglected for the last year.. sob sob!

Oh and at 6 am today, I found out that it was STILL the 5th of June back in the US of A and that I won a lottery to an apartment of my choice at Rice Graduate Apartments so finally something going well..

Need for Speed

2009-06-05T07:47:00.004+05:30

Finally started with my car driving lessons! I was supposed to begin in early December of last year but with the applying to various universities going on, time was not easy to find and well, I procrastinated a long time. But with 3 months of nothing else to do than get ready for Rice University, I finally went ahead and started it.

So it was 7:30 am on Wednesday, the 3^rd of June and I was sitting in a white Maruti Alto feeling the power of a 1250 HP engine beneath me.. Needless to say I was thinking more along the lines of the popular Need for Speed gaming franchise and started out great- ready to handle the clutch and manually shift the gears from the word "Go" until the near miss some 10 mins later..

About 400 metres away from the BASF company branch here is a small road frequented by bus drivers who are in a rush to get to their next stop and if you have ever been here then you know how maniacally these guys drive.. This particular stretch of road had a steep turn downhill and I was going uphill at about 45 km/h when two, not one, buses come hollering down the road at great speed trying to overtake the other.. I admit I had a heart beat that would have made Usain Bolt proud but was aware enough to use the handbrake which I knew did exactly what the games told (Who says gaming is not useful?? ) and steered to the left of the road which was about 20 metres above a thorny ravine and then steered back onto the road just as we were about to fall in! I deserve the Bravery Award from the President, I say..

Oh I am just kidding, the instructor pulled over to the road before I could do anything and thats that! Seriously though, nothing ever happens when you want it to- least of all during your very first car driving lesson.. I have had two classes so far and its been a cinch till now: Looks like that Merc is not far off :P

Recent Videos and Films..

2009-06-02T07:09:00.005+05:30

I finally saw Delhi-6 despite everything everyone said and let me tell you this: I liked it! Of course always in the back of my mind remained the criticism of a friend who thought the movie went all bad when the hero came back to life and I kept waiting for it to happen.. Kinda dumb given that it was at the very end and so never spoiled the film for me.. For those who didnt like it, how the hell did you like Rang de Basanti then? Here too the moral fabrics of society are tested and its made conscience by 2 superb instances- The "Monkey Man" and the "White Pigeon".. Does no one remember the terror of the Monkey Man and his successor the Bear Man in various places of north India about 10 years ago? Didnt anyone realise the pigeon when tied up stood for the plight of the Indian girl and later when free but remaining there stood for all those people of India who complain about anything and everything bad going on in the nation but still love it so much that they are unable to go away? Its ironic then that such people who dont appreciate this nation remain here while others go away, more so given that I wont be feeling the Indian flavour (Original, atleast) for 18-20 months once I leave for Texas in some 75 days..

A friend also brought to my attention last night that Hindi films arent being released because of a strike in bollywood- I never even noticed this! Trouble is I am hooked to getting my jolly's off the internet and use my laptop to see the avi versions of any video I want to. To that my college has done a lot with over 25 TeraBytes of data shared among the inmates and more data getting added by the minute. For those with space to afford (like my 500 GB laptop, Oh I simply cant stop showing it off) there are now HD versions available with each film consuming about 7-10 GB each.. Given this clarity, superb audio options and the incredible convenience/cost savings who would go to the multiplex often? Not me..

I have also been making great use of my broadband internet at home and so far I have the following series with me which are finished/updated to latest episode:-

1) Friends

2) Seinfeld

3) LOST

4) Terminator- The Sarah Connor Chronicles

5) 24

6) The Big Bang Theory

7) Dragon Ball

8) Dragon Ball Z

9) Dragon Ball GT

10) Smallville

11) Hustle

12) Prison Break

13) Scrubs

14) Fringe

15) House MD

16) The Entire Life collection by David Attenborough (Close to 50 GB of intense nature films)

17) Two and a Half Men

To be taken soon:-

1) Damages

2) According to Jim

3) Aliens in America

4) Taken by Steven Spielberg

5) Chuck

6) Numbers

Clearly I am jobless and need entertainment till august :D

Speaking of LOST though, an eerily similar situation unfolded yesterday with the Air France 447 aircraft missing off the coast of Brazil.. My hopes are they are alive and are rescued soon!

On Engagement

2009-05-30T07:34:00.004+05:30

No, not me! Heaven forbid for I am just 21- Way too young to be sacrificed.. I speak of my cousin sister, Navya Prabhu, who got engaged this wednesday (27-05-2009) at the age of 23 and I was in apprehension the entire week knowing that my generation was growing up. I always knew it was gonna happen eventually but who-really-gives-a-sh*t-till-you-see-it-happen-before-your-own-eyes?? Sorry for the emphasis but I cant express it any less. Then I think of Rice U and a content smile comes- I got atleast 6-7 more years of single life..

Back to the topic, if you are a typical Hindu then you would have been to one of these events. For those who came in late, a simple procedure involved:-

1) Get bored of single life/Be really content but your parents get in the mood to be..well.. parent-y

2) Parents inform 90% human population (No, we still dislike George W. Bush and the terrorists) about a prospective match-up

3) Jobless people (Nearly always home-makers, female) get together to do the primary screening of candidates- Note here that a 6 figure, NRI holds more weightage than whether or not he is gay, a transvestite or simply has a criminal record

4) Once a primary screening is done, the Priest is beckoned. This person has the power to decide whether or not two people are compatible, to heck with what those two think: I swear, sometimes I think the Nazi's are still around!

5) If the horoscopes (Old Jerry Seinfeld's comedy routine material) match, photos galore are sent to both sides. Poor parents are still unaware of photoshop at this point!

6) The "Girl seeing" ceremony, typical tradition that has continued from the Jurassic period and is highly male dominated (Why is there no "Man seeing" ceremony then?)

7) If approved, the get to know each other part: Oh this part is enjoyed most by Phone operators who see a surge in calls/sms. The only modern touch to this neanderthal procedure sees less eye-to-eye and more phone screen-to-phone screen.

8) Engagement time and invitations printed and given in person (Notice the irony with the last point) to most, if not all, people.

9) The actual ceremony itself which is a huge pain to all senses, except if the food is of a good standard. But given that most such ceremonies simply HAVE to be in a temple hall, keep hoping!

All in all, its a custom which seems to get more exuberant with time but never fades away. I sometimes wonder what all the fuss about engagement is: Everywhere else, all I see is a guy (and in rare occasion, the gal) propose to the partner with a simple "Will you marry me?" the answer to which usually depends on the size of the ring these days, and thats it! I sometimes think this whole drama is for nothing, except for keeping in touch with your Indian roots..

Random thoughts..

2009-05-30T07:10:00.004+05:30

Enough of the copy-paste already! I have been wanting to write for such a long time here but somehow find no time to do so- You see I am not the type of person who writes a blog post in a word file and then uses it to do another copy-paste here; rather I write here itself from scratch. That poses a problem when it comes to posting regularly...

Quite a lot has happened since I last wrote here, the biggest of course being the re-election of the United Progressive Alliance (UPA) to the helm of the Indian Govt. This election was special for me in the sense that I wont have the chance to vote again for another 5-6 years atleast while I spend my time in Houston, Texas. Also for the very first time I voted against what everyone in my family does and actually went against the entire lot this time. Maybe it was the various anti-non hindu incidents here or the extreme hindu following which had a van load of local guys, people I knew from childhood, come to every household demanding they put up a Hindu flag and vote for the BJP. Maybe it was just years of seeing communalism spread all over this beautiful place I call home but I voted for the Congress this time around and I am proud that I did so even if the candidate lost: I made my choice and voted for it.

I was thinking of utilising section 49-0 but I was pretty sure the election committee were blissfully ignorant of it and this would just have kept up proceedings for a long, long time. But I urge every reader here to know that they have the right to appear for voting, take the voting ink on their index finger and then inform the committee that you feel no candidate is worthy of your vote. More info in a simple blog here.

Oh and the IPL just concluded its second season and I just cant keep away from mentioning cricket these days, can I? Well I had been a loyal Royal Challengers, Bangalore supporter from the beginning and all I can say is "Wait for the Champions League, DC fans!" Cricket is grabbing my attention a lot now that its less than 80 days that I go to Baseball/Basketball/Rugby nation.

Speaking of going to the US of A, things are getting heated as I got a lot of things to do: Pay more fees in USD, schedule a Visa interview and hope to clear it, book airline tickets Mangalore-Mumbai and Mumbai-Houston, get all things needed for a 5 year stay, and hope not to have to cook! I hate cooking, surprising given that I actually am a pretty good novice at it but I despise it... The only good thing I can see sportwise is that I will be watching WWE live there :D

Oh I know what you are thinking, and just to make your point clearer I present 7 minutes of the most insane moments in wrestling (Watch in high quality and I dare you not to cringe!):-

I do declare!

2009-05-29T07:49:00.003+05:30

Courtesy of Cricinfo, one of the best articles I read:-

I do declare

Few incidents have been as cynical as Somerset's declaration after one over of their Benson & Hedges Cup one-dayer against Worcestershire

Martin Williamson

May 23, 2009

Brian Rose: at the eye of a storm © Getty Images

As the 1970s gave way to the 80s, cricket's laws began to be challenged as never before. Whereas previously captains and players had abided by the rules and regulations, they now started to look with increasing cynicism to exploit loopholes the lawmakers had never envisaged. One-day cricket, a relatively new phenomenon, was not as wrapped in tradition and so was seen as fairer game.

In November 1979, Mike Brearley caused outrage when, with West Indies needing three to win off the last ball of a one-day international in Sydney, he put all his England fielders - including David Bairstow, the wicketkeeper - on the boundary. The crowd booed, Brearley was vilified by an Australian press that already regarded him with a dislike only rivalled at the time by Iran's Ayatollah Khomeini, but the result stood.

A little over 14 months later, with New Zealand needing seven to beat Australia in an ODI in Melbourne , Trevor Chappell bowled the last ball underarm - under orders from his brother, Greg - so depriving Brian McKechnie of the chance of tying the game with a six. Greg Chappell was roundly and vehemently condemned, but again his action was within the laws as they stood. In both instances, adjustments were quickly made to ensure there was no repetition.

But perhaps the most cynical stretching of the laws took place in the much quieter surroundings of Worcester, whenBrian Rose, captaining Somerset, declared after one over of a Benson & Hedges Cup zonal match. At least in the first two instances the crowd had had a full day's entertainment, and only the denouement was unsatisfactory. At New Road in May 1979, most spectators hadn't even taken their seats by the time the game was over.

Somerset travelled to Worcester knowing that under the rules of the competition they would qualify for the quarter-finals as long as they did not lose by a heavy margin. Even if they won, Worcester (and Glamorgan, who were seemingly assured of an easy win over Minor Counties South) could only finish on the same number of points as Somerset; they needed a conclusive victory to overtake Somerset by virtue of a superior strike-rate, which was used to separate teams on level points. By declaring their innings after one over, Somerset would lose to Worcester - but that didn't matter as it would mean that they could not be overtaken on strike-rate.

Rose realised that what he was planning was likely to cause an outcry, and checked with Donald Carr, the secretary of the Test & County Cricket Board (the forerunner of the England & Wales Cricket Board), whether it was legal. The reply came that while it was within the laws as they stood, it was certainly against their spirit and that there would be "repercussions".

On May 23, the day originally scheduled for the game, there was no play possible, and so the teams reassembled the following morning when, although it was grey and damp, the match started on time.

Rose won the toss, batted, and after one over - a maiden bowled to him by Vanburn Holder, which included a no-ball - he declared at 1 for 0. Worcestershire took 10 balls - with Glenn Turner scoring two singles - to win a game that lasted 18 minutes, including the statutory 10-minute break between innings.

The hundred or so spectators inside New Road were incensed, while those still arriving were understandably bemused when told the game was over. Mike Vockins, Worcestershire's secretary, refunded all the gate money and slammed Rose's actions as "an absolute disgrace". Somerset packed their kit, and within 15 minutes of leaving the field were heading home, although Rose had to endure heckling as he left the car park.

One man who had driven 150 miles to watch the game angrily told reporters he had decided not to become a Somerset member. Another, a schoolteacher, explained he had brought a coachload of children to see the match. "The kind of lesson we have seen today is one no boy ought to be taught," he said.

Alan Gibson, whose reports in the Times often included long descriptions of train journeys to and from games, arrived at Worcester station only to be told "by a kind porter who knew what I had come for" that he best jump on a train back to Bristol. "He had heard the news from the ground and was angry."

One of the most bemused onlookers was Charles Burnett, who was the Man-of-the-Match adjudicator. After some deliberation he wisely decided that nobody was deserving of the award, explaining it would be "improper".

Rose was unrepentant. "I had no alternative," he said. "The rules are laid down in black and white. If anybody wishes to complain, they should do it to the people who make them."

Spectators at Somerset's game following the declaration have a dig at Rose © The Cricketer International

That rather simplistic disregard for the paying public cut no ice, and the outcry was almost universally damning. Few disputed that Rose had acted within the letter of the laws even if he had run a knife through its spirit. "He did not infringe them," John Arlott noted in the Guardian, "he exploited them." In a lead editorial two days later in the same paper, the TCCB was blamed. "If… a day's play consists of one extra and two runs then the fault lies not with the Somerset captain but with the legislators who provided for such an eventuality." There were exceptions - the Daily Telegraph spluttered about "cynical tactics" and accused Rose of "plumbing the depths".

Rose was the scapegoat, even though it was widely acknowledged that he had flagged his intentions with a number of people within the club and discussed the idea with his team, who had agreed. Somerset's own committee immediately backed him, although making clear their displeasure at his actions. They also offered to replay the match, but the crowded schedule made that impractical.

The TCCB responded by calling an emergency meeting of its disciplinary committee. Eight days after the match, that committee voted to expel Somerset from the competition by 17 votes to one. Even Somerset supported the motion, with Derbyshire, for reasons known only to themselves, the sole opposition to it.

The TCCB slammed Rose's action as being "against the spirit of the game" and said that it had "brought the game into disrepute". Colin Atkinson, Somerset's chairman, apologised for the incident, which he described as "wholly indefensible".

Even so, the outcome might have been right, but the way it was reached did not go down well, with many observers accusing the TCCB of punishing a side for a breach of rules that did not exist.

The real irony was that Somerset would have qualified for the quarter-finals even if they had lost; Glamorgan's game against Minor Counties was washed out and so they were denied the win they needed to finish on level points.

In the following month's Wisden Cricket Monthly, the editor, David Frith, wrote that he hoped the events at New Road had restored some sanity to the game. "I have been waiting, with some trepidation, with six runs needed off the final ball and a lot of money at stake, the bowler informs the umpire of a change of action and rolls the ball along the ground. Maybe this dreadful vision will now vanish."

Sadly for Frith and the world of cricket, 20 months later Chappell did just that at Melbourne.

On White, Bald Men and Flippin' Da Bird!

2009-05-03T07:14:00.007+05:30

The following article is by Tishani Doshi (courtesy Cricinfo) and is very relevant to my comments below it:-

Racket sport

Why the IPL is noise pollution by another name

May 1, 2009

So what did he say when he learned he hadn't made a hundred after all? © AFP

Last night I dreamed I was watching a movie in a theatre with those weird, bald people from the Vodafone commercials. They were sitting in the row behind me, and then one of them started shrieking into his cellphone in that high-pitched Tamil-Japanese nonsense language of his people, and I turned around and beat him over the head. Okay, I'm lying. I didn't really dream about those people, but I did go to a movie theatre, and a guy did start talking into his phone, in Tamil, and I did hit him on the arm and warn him if he didn't *£#^ing switch his phone off, I would do it for him.

What can I say? I have a low threshold for noise. And upping my daily quota of cricket hasn't made things better. First of all, I no longer have any idea about what's going on in the world, other than a very peripheral knowledge of the swine-flu pandemic, madness in Sri Lanka, and courtesy this morning's Hindu, a delightful picture of the entire Bachchan family with their middle fingers up in the air (to show they've voted, but still very funny). Secondly, the Extraaa Innings theme music hasn't helped my phonophobia any. Can someone please explain to me why commercials have to be so much louder than the actual television programmes? Do we really need to be hectored authoritatively, without any trace of nuance or humour, over and over again?

At this point in my rant, I think I had better differentiate between sound and noise. Sound is what we hear, noise is unwanted sound. So the difference between sound and noise depends very much upon the listener and the circumstances. It's like those HSBC commercials with the picture of the sitar player: one sign says "pleasure", the other "torture". It's all about perspective. But surely there are some absolutes? There have to be. Those cars reversing to the national anthem? Sivamani and his bleeding drums? Surely no one can find that pleasing?

Maybe it's just me. Maybe I'm just extraaa-sensitive. But what's really frustrating is that the things I'd like to hear are muted, and the other things are blasted. Who wants to hear Raveena Tandon going on about her husband (who looks like Daniel Vettori, according to her)? I'd much rather know what they're talking about in the dugout, or what the wicketkeeper is saying to the batter at the crease. What was Adam Gilchrist saying to the umpire after the Deccan Chargers lost to the Delhi Daredevils yesterday? What did Suresh Raina say when he got back to the bench and found out he'd actually only made 98?

And then there's beauty in wordlessness. The actions that require no subtitles or voiceovers. Robert Quiney giving Swapnil Asnodkar a tender knock on the helmet after the latter hit Albie Morkel for a six. And then, the very next ball, Asnodkar going for a double out: hitting his own stumps and being caught by Badrinath. What do you possibly say about that?

I'll leave you to chew on that for a moment, while I excuse myself. Because you see, my team kicked ass yesterday. I'm off to go shout it out from the rooftops!

Tishani Doshi is a writer and dancer based in Chennai

Read it?? That by the way is just part of the many humourous articles on IPL page 2 on Cricinfo including the various Rules from Hell which my gtalk id boasts of as status messages. Ok enough advertising! The reason I did a ctrl+C, ctrl+V on that post is because he speaks on 2 topics which have caught mine, and surely many others', attention in the last week- namely the Vodafone series of ad's and the...well... this:-

In fact an article has been written just on this in the Times of India blog (Surprise, surprise!) which is seriously worth reading here. I saw a similar version of the pretty Bachchan family (They got spies everywhere! EVERYWHERE!!) showing the entire nation that they have voted in grand style. If only Mrs Jaya Bachchan had complied, that would have been a proper fcuked-up picture in more ways than one! Whats with the middle finger getting the voter ink anyway? The common man gets it on his right index finger and even though he/she knows its indelible, tries to wipe it after voting. But when realised that its gonna stick with you: Viola, it becomes a thing to flaunt (I've voted, Have you? *smug look*). At times where the bollywood stars are no longer big for reverence, such images serve to lighten the election mood. Oh did I mention India is having its Lok Sabha elections? Dakshina Kannada recorded a record (WTF??) 74.2% voter turn-out and I suppose a lot of hype generated with the Mangalore Pub incident did help there.

But wait: I see a few bald men. They are white. They speak tamil/japanese/djiboutian all together. They are coming towards me. And suddenly.....

I dare you to say you haven't seen any of these ad's if you are in India! They are everywhere: TV, Radio, Bill boardings, Traffic Signals.. Vodafone has something huge on its hands here and the best part for them is that they keep adding new versions for their various services. I would much rather see this on tv once rather than get the same irritating messages on my IDEA phone (What an Idea, Sir-ji) but the grapes are very sour on this line (Pun intended, hope you got it).. In fact, to tell you how big this is The Hindu has had an article on this here which says those little white people are indeed Men called "ZooZoos" and that Facebook has a fan club for them with more than 30,000 fans already! Who am I to argue with them? And hey if you are so big a fan of these ads then you are free to download them at this link, courtesy Vodafone of course. Or you can wait a while for the Official ZooZoo merchandise to come out (Not a joke, they are making it as we speak!). So while you peeps take a look at those links (I swear they are ALL worth reading), I am gonna go download TV series' episodes.. Farewell DC++, we shall miss you greatly! Sob sob..

A get-together: One last time!

2009-04-21T05:51:00.007+05:30

No guys, that "lunch" tomorrow doesnt count as the profs are gonna be there! So what we had yesterday was our last meet and I am glad to say that 28 of us 34 students were there.. But why am I starting in the middle?

Right from over 2 years ago my classmates have been asking for an invite to my home and it finally happened last night. I sent a message to all 33 classmates on Sunday and 24 confirmed that very day. Of course I had to attend a friend's wedding and then got lazy to do anything else that day so it was all left for yesterday itself..

Monday, 8 am: Menu gets decided! And correct me if I am wrong but there was so much variety that nearly everything had left-overs.. Debanand had requested my mom earlier to make that "banana juice" he loved the last time he was here and I am pretty sure that was the killer item of the evening: So simple, yet brilliant for that hot evening. Proof: Sindhu had 3 glasses despite being allergic to bananas and her slightly swollen tongue showed it!

Anyway the menu: Banana shake/Coke/Orange soda/Lemon soda, Cabbage bajji, cauliflower bajji, Soya chilli, Prawn/Chicken/King Fish fry, Veg/Chicken Fried rice, Curd rice, Butter Chicken and 2 varieties of Ice cream: Over kill!! But then my parents knew it and with the typical Konkani attitude, they wanted this party to be something everyone will remember forever..

It was a great party, with 28 of the 34 in class coming, and we all had great fun. I didnt like the part where my mom decided to show the girls my kiddy pics when I was out getting a few of my friends but then no harm done- Its all over now.. But I am still haunted by the girls comments "Awwwww! Soooo cuuuuuute", "What happened to you now?", and "Hey he looks like a girl here!"... Brrrrrr!

Also can't ever forget that hideously sad PJ from those two fungi-like hosts "Bhakwas Band Khar" on 9x M, with 3 other guys (Using Ghabbar Singh's "Kab hai Holi?" dialogue to prove a baby lion (cub) is the festival Holi!)

Thanks guys for coming, and making yet another special memory for all of us! Thanks Ravi/Deba/others for making that (yet another) senti slideshow of pics..

Final B.Tech exam!

2009-04-18T10:54:00.005+05:30

Sigh... I know I will get a lot of flak for this but I am already missing yesterday's test! Dont get me wrong- Its not the studying (Well cramming actually!) but more the atmosphere that we guys create before/during/after the last test of a semester. I remember and have written about how the PE exam last semester was and this time too the feeling of experiencing the very last exam in NITK was huge..

It didnt help that we had probably the toughest subject of chemical engineering as the last exam for most of us (There are about 10 people who have 1-2 more tests) and anyone who disagees with me should know that Sir had mighty pity on us when setting the question paper: CRD IS TOUGH!!

We also had to run around preparing the project thesis report in a matter of 2 days and getting it approved by the guide before learning of numerous little technical details, after incorporating which, to take printouts and take various signs before finally submitting to the department.. All this with 1 week of college life left for 90% of the people! No wonder we didnt like to prepare for this test...

With this mind frame in motion, we even tried to call sir before the test and try to get him to "not correct our endsem answer scripts and award grades based on internals & how he sees fit" but with a major flop as it never actually materialised! Preet finally got the balls to call sir to ask him about "possible important topics wrt exam" only to hear this- Everything is Important!

So I arrived at 1:30 pm yesterday to the department to see the M.Tech guys (with whom we had this subject) slogging galore and so quickly went over to another class room where we eventually all wrote the test and had a blast! The next half hour was spent mostly talking over how we are gonna get screwed and why we had studied very little & remembered nothing... At 2 pm come the invigilators and the test begins...

All was going as usual with the now-common water drinking session of people in continuum but then came the episode of "Manish and his Chits!!!" For reasons yet unknown to all of us, he decided CRD was best served with micro's and was caught by none other that Dr Rajmohan who took great delight in denouncing him to everyone around. But the faculty was good enough to ask him to give up other chits and asked us all too lest the "Flying Squad (Lol@name)" catch him and send him out of the exam hall. That was the first time I had ever heard of any such squad and luckily we got the chance to finally meet this infamous 5-man team whose sole responsibility is to apprehend mischief-makers in exam halls- How sad is that??

Shreekumar sir calls out Manish and gives him his half hour Gita version while the F.S made its entry. All mobile phones (mine included) were being threatened to be confiscated when they realised close to 75% of the students had their phones with them: Clearly we were not in their NITK zone of comfort! Nothing happened and they departed but later in the evening I heard of tales where F.S took their time having fun with 2 students who had got their mobile phones/had brought the library card instead of the ID card- Big deal! Most of us come carrying a single pen, not even a calculator, and well, WHO THE HELL WILL VOLUNTEER TO WRITE A TEST FOR SOMEONE ELSE??

So finally chymes the clock at 4:55 pm (Actually it didnt, the bloody clock hasn't worked in a month!) and the last 5-6 who were staying back just for the heck of it (Except Ra-gay-esh) came out finally to the delight of everyone waiting outside who couldnt stop smiling at having come out Graduates of NITK informally atleast.. It was a great feeling which I cant do justice by expressing in words.

At the end I recall a most hideous PJ by Dr Saidutta yesterday to Mishra on observing the class T-shirt: "Oh it has the names of all the subjects on it? Hopefully the info will finally diffuse into yourself now!" You shall not understand if you aren't a chemical engineer at NITK- Thats what we are now :D

WWE Draft 2009

2009-04-16T07:00:00.000+05:30

Courtesy of TPWW:-

Complete Breakdown Of All 36 WWE Drafts Comings & Goings

A total of 36 WWE Superstars changed brands following Monday’s live Draft on Raw and today’s Supplemental Draft on WWE.com. Here is a complete breakdown of all the moves.

Superstars Joining Raw (+15)
» Big Show
» Brie Bella
» Carlito
» Chavo Guerrero
» Festus
» Hornswoggle
» Maryse
» Matt Hardy
» Montel Vontavious Porter
» Mr. Kennedy
» Nikki Bella
» Primo
» The Brian Kendrick
» The Miz
» Triple H

Superstars Joining SmackDown (+15)
» Alicia Fox
» Candice Michelle
» Charlie Haas
» Chris Jericho
» CM Punk
» Dolph Ziggler
» John Morrison
» JTG
» Kane
» Layla
» Melina
» Mike Knox
» Rey Mysterio
» Ricky Ortiz
» Shad

Superstars Joining ECW (+6)
» DH Smith
» Ezekiel Jackson
» Hurricane Helms
» Natalya
» Vladimir Kozlov
» Zack Ryder

Superstars Leaving Raw (-12)
» Candice Michelle
» Charlie Haas
» Chris Jericho
» CM Punk
» Dolph Ziggler
» JTG
» Kane
» Layla
» Melina
» Mike Knox
» Rey Mysterio
» Shad

Superstars Leaving SmackDown (-19)
» Big Show
» Brie Bella
» Carlito
» Chavo Guerrero
» DH Smith
» Ezekiel Jackson
» Festus
» Hurricane Helms
» Maryse
» Matt Hardy
» Montel Vontavious Porter
» Mr. Kennedy
» Natalya
» Nikki Bella
» Primo
» The Brian Kendrick
» Triple H
» Vladimir Kozlov
» Zack Ryder

Superstars Leaving ECW (-5)
» Alicia Fox
» Hornswoggle
» John Morrison
» Ricky Ortiz
» The Miz

Some points..

2009-04-15T07:37:00.002+05:30

* Got myself a new old scanner (Its a gift from a friend who no longer wants it, looks new still): The possibilities are endless but I am gonna begin with scanning all the old photographs which will wear out with time

* Made the decision to join Rice University for the next ~5 years, this settles it as far as BPCL and UAlbany go

* Finally got that elusive microbe isolated and grown in agar slants, will be sent today to NCCS, Pune for identification: Good chance that its a totally new species!

* Had the final endsems begin yesterday, and thus it was that I had possibly seen some of my friends for the very last time (those who haven't taken the other subject that I have)

* Got the chemical branch T-shirt and the annual smriti yearbook/dvd set: Has consumed me all day and will do so today.. Need to study for the final test while making the project report too :(

Ring Ceremony '09

2009-04-08T06:34:00.010+05:30

I suppose the last official recognition of our having being students at NITK was yesterday. Any and ever college these days decides to give a ring of honour to its outgoing students but as I learnt from Prabha, some canadian delegates were responsible for making our turn the 45th time this event has been held at NITK. Of course she also mentioned those very canadians to have played a role in the formation of this institute itself so you go figure why the NITK anthem is not sung to the tunes of "Oh Canada..."!

Forget Canadians now, they have their own country! For us people though yesterday was all about coming in formals the very last time in college and let's just say the response to the 5 pm calling on the invitation was... ahem... luke-warm at best. Heard and seen at Final Hostel block from 4:45 pm to 5:45 pm yesterday:-

"Abey log bahut honge yaar bathroom ke baahar" ( Dude lots of people are gonna be outside the bathrooms now")

"Chehra saaf karna hai par bahut aalsi ho gaya hoon" (Need to clean up/Shave but too lazy)

"Kisi ke paas extra formals joote/tie hai kya?" (Anyone has extra pair of formal shoes or a tie?)

"Chod na yaar, ye NITK timing hai. Hum 5:30 ya 6 pm ko nikhlenge." (This is NITK, lets leave at 5:30 or 6 pm)

Avinash to the above: "Some placement meet starting now da, lets leave at 7.

In chorus, many others: "Yes, We Can!" (Uhmmm... Ok!)

And as usual I was there at 4:30 because I needed another tie in case the one I had on was not looking good on me. But then, very little does! So it was in full formals that I decided to put more load on the earth mother and sat down outside the entrance steps to the final block, talking to friends while watching a parade of batch-mates go over to the 4th block carrying a bucket and a towel to take that rare bath. I can't blame them: No water again in final block!

I got an impromptu lesson on how to tie a tie from The Singhai, only to forget it in 5 mins. Kiran came to the rescue when he got his car here: Its about 800 m to the Student's Activity Centre (The "supposed" arena for the ceremony) and in the 35 degree, +95% humidity weather we were glad to get that ride- Only to see that we were to sit in a huge huddle of students feeling every bit of the Indian Summer even at 6 pm. Somehow this evening we had a friendlier connection with the faculty- especially Dr Saidutta and Dr Shreekumar and they entertained us with their tales of this ceremony. Dr Saidutta showed us his ring which must have been magnificent in 1981, and the NITK watches to be "bought only at the alumni meetings". So here we sat awaiting the ceremony to begin...

When all the students finally came, the rain gods were ominiously making themselves heard in the open amphitheatre. Sad jokes and a few hundred pics later (Let's just say some pics are gonna be more popular than others, poodiamma!) the ceremony began with the customary speeches. A guy from computer sciences branch gave a rocking speech which I frankly think was accentuated mainly because of his accent. And then there was Prabha...

Prabha's speech will be remembered less for the content but more for the rain which came during it! Nearly everyone was more into the rain and the sudden cool weather with expressions ranging from "Sexy shit man! I love this weather even if I am in a burgundy sari and heels" to "Hey good! Ceremony postponed for tomorrow. So we get 2 ring ceremonies."... Utter chaos with some mad people (I included) just taking it all in with face turned to the heavens and others running for the SJA (Silver Jubilee Auditorium) where secondary preparations were being done. In the end a poor M.Tech (I think) guy was still talking and we all scattered like bunnies in the downpour and the power failed to just add to the mood.

Have you watched Jurassic Park and wondered how it felt running with a coupla hundred people at night in the rain with the raptors close on your heels? Well there was no imminent danger here but when you have about 700 people running on a small strech of road, you tend to get a rush of adrenalin. I am pretty sure it was more from the non-seasonal rain than anything else but hey- I'll take it!

Just as we reach SJA, power is back- Nice trick! Somehow in the madness, all chemical guys make their way to a decided seating area with lots of fans and free space around. And somehow in 10 mins time, the ceremony commenced from where it had left off. Somehow the rain had made us non-responsive to the ceremony and so the next hour or so was spent idly chatting and taking still more random pics- Probably because we all knew inside that this night may just have been our last time together! A few speeches later, it was time for the rings to be given..

The dept faculty made their way to us with the rings and all had the chance to get that ring on. I can't help remember one incident though: Christina walks over to the HoD and puts her left hand out and tells its the 4th finger she had chosen for the ring. Being a christian, she had no idea its the engagement finger for us Hindus and so she comes back with the ring in another finger and a confused look on her face. She says "I dunno why GM didnt put the ring on this finger! He kept saying something like "Udupi, Udupi!" Any idea why?" When Prabha realised it was actually "Would-be" it was a moment of gratification for "blondie prabha" who managed to get us all laughing at someone else for a change. Apart from that, there was Sindhu's "marriage plans in Jamaica" in ~3 years, Indu booking Sandeep to catch her ring in case the HoD decided to throw them at us (Lol!) and Sindhu & I having a war on Photoshop reduction- Those who know will know!

Some people thought it was cool to get a pic on the dias. Unfortunately for them, so did many others. In the end there were about 150 people cramped on the stage and the poor photographer moving back all the time in order to get everyone in the frame. All this time, we were grumbling about the dinner we were promised and it was here that the "Shameless Hoggers Inc" was born. I have no idea how long it will last but hey- I am a founding member of something atleast!!

Finally the National Anthem is sung and we are all invited to the Sports Complex for dinner: Only to see a huuuuuuuuuge line of people in front waiting before us to be served. So we (2 chemical, 2 from meta) go to the empty Food Court and head back to the complex just in time for ice-cream. Sadly this is where the night ended for me: Being a dayscholar is tough at night with no means of transport after 9 pm. So while I was making preparations to go back home, the others either went back to SAC for the Movie screening of "Sarkar Raj", went back to their rooms or simply went about in small groups to chat till the wee hours of the morning...

Kiran best expressed his feelings regarding the ring in his current gtalk status: "This ring is a thing which clings onto your wing and pings you everytime only to sing that NITK was the sling which fling you in full swing to only bring you back like a real king"

Written a lot today, will add a few pics as soon as I get them! Till then I need to stop laughing from the last spam message I got in my gmail folder: "You have a naked video of yourself at youtube.com! Click on the below link to remove it".. Nice huh? Finally an imaginative spam message... Adios!

Some admits and a tough decision

2009-03-27T07:55:00.012+05:30

Right now I am in a tough spot, but because I am spoiled for choices! When I got that selection letter from Bharat Petroleum Company Ltd (BPCL) and its ~8LPA govt job, I was thrilled because it ended a series of rejects by other companies who were mostly insecure that I, with my 9 pointer, would end up continuing my studies. But at that time all I wanted to do was get a good job and start earning for myself. All this was till sept 19, 2008.

On Sept 8, 2008 I wrote the GRE with less-than-average preparation and got the less-than-average score of 1270/1600 which I later learnt was pretty good for that year. At this time, after listening and observing the fervour with which my classmates wanted to go abroad for M.S/PhD, I was beginning to feel the bug a little bit. So I decided to go the full monty and apply to a grand total of 5 universities. The TOEFL score of 113/120 added to the confusion and well there I was- sending 5 application packets: Stanford (PhD), Cornell (PhD), NCSU (MS), RICE (PhD) and SUNY-Albany (MS).

On Feb 18 I get the following mail from Stanford:-

DEPARTMENT OF CHEMICAL ENGINEERING

STAUFFER III- ROOM 113, 381 NORTH SOUTH MALL

STANFORD UNIVERSITY

STANFORD, CALIFORNIA 94305-5025

February 16, 2009

Dear Mr. Varun Shenoy Gangoli:

Our admission committee appreciates the significant time and effort that you and your recommenders made to submit your application for admission to our Ph.D. Program.

Our committee members carefully reviewed your application. Each year, the number of applicants seeking admission to the Ph.D. program in Chemical Engineering far exceeds the number of available openings, with the result that the competition for admission is very high. We regret that the department is unable to offer you a place in our entering Ph.D. class of 2009-2010.

Thank you for your interest in Stanford University. We wish you the best of luck in your pursuit of Ph.D. studies elsewhere. However, if you wish to be considered for our separate, terminal M.S. degree program, please contact Ms. Cosby using the subject line: APP-MS-[your last name].

Sincerely yours,

[signed]

Stacey F. Bent

Chair, Graduate Admission Committee

Professor of Chemical Engineering

Strike 1! Of course I had no illusions of getting an admit here, its simply that good a university that nearly all IIT students get rejected. So I took it in with a shrug and waited for more news. 3 days later comes in the reject from NCSU. Stike 2!

Now this was a shocker as I had easily expected an admit here. For reasons unknown, NCSU has rejected every applicant from NITK and I may be justified in believing that this is because of their funding program. So here I was 0-2 and beginning to mope a little as news of other people getting admits came in. At this point BPCL was my future! Then on March 6, it came- my first admit! Although a secondary programme, I was nonetheless pretty pleased:-

2/13/2009

Varun Shenoy Gangoli (Student ID: 000964762)
"Vasudha",Ashraya Nagar
Kadambody, Surathkal,
Mangalore, Karnataka 575014
India

Dear Mr. Gangoli,

We have received your application and supporting documents for admission to the Graduate School.

After careful consideration, the faculty of the program to which you applied (Chemical Engineering - MS) has not recommended your admission. Their decision was based on the requirements of their particular program, the qualifications and performance of students currently studying in the program, and the number of new students that the program can accommodate and support. I concur with their decision and must therefore deny your admission.

I appreciate your interest in the graduate programs at North Carolina State University, and I wish you well in your future endeavors.

Very truly yours,

Duane K. Larick, Interim Dean

___________________________________________________

Cornell University

School of Chemical and Biomolecular Engineering

120 Olin Hall

Ithaca, New York 14853‐5201

t. 607.255.8656

f. 607.255.9166

March 6, 2009

Varun Shenoy Gangoli

Vasudha, Ashraya Nagar,

Kadambodi, Surathkal

Mangalore, Karnataka, 575014

INDIA

Dear Varun Shenoy:

On behalf of the Graduate Professional Programs Committee, I am pleased to inform you that you have been admitted to the Engineering Division of the Graduate School for the Fall 2009 term as a candidate for the Master of Engineering (Chemical) Degree. Your admission is contingent upon certification of adequate financial resources for this nine-month academic program. We are unable to send you the Certificate of Eligibility (Form I-20) until we are certain that you have the necessary funds to pursue graduate work at Cornell and we receive a photocopy (or scanned copy) of your passport. Please find attached the Financial Responsibility Form for 2009-2010. Please complete this form (or have your sponsor complete it) and return to Shelby Clark-Shevalier by mail (or send an electronic version to Barbara Edinger at the Cornell Graduate School at: bae2@cornell.edu).

Although your application has been acted upon at this time, final admission is contingent upon satisfactory completion of your baccalaureate program with academic performance comparable to that completed to date and receipt in this office of a transcript containing certification of your degree.

We very much hope that it will be possible for you to join us this fall. If you have any questions, please do not hesitate to contact me or Shelby. Shelby can best help you with administrative questions (housing, travel, etc.), while I can help you with questions concerning the educational aspects of the program. Please visit the Cornell Graduate School Response Form 2009 as soon as possible, but no later than April 15th, to let us know your decision: https://apply.embark.com/grad/cornell/response/24/ Also, feel free to contact our International Students and Scholars office which is an excellent source of information. They can be contacted at: International Students and Scholars Office, B50 Caldwell Hall, Ithaca, NY 14853; (phone: 607-255-5243; or fax: 607-255-2778). You can also access their website for more information: http://www.isso.cornell.edu/

We will be pleased to have you in the Master of Engineering Program and will try to make your graduate experience at Cornell as educationally rich as possible.

Sincerely,

William Olbricht

Professor & Master of Engineering Representative

Enc.

______________________________________________________________________________________

Hmmm! Not that I would have given up on BPCL yet but I was actually talking to a senior about getting research assistantships to help sponsor this course "in case I took it up". BPCL was looking bleak with every passing hour now.

I suppose the big break came on March 15 when I heard from RICE U:-

Dear Varun Shenoyg,

Congratulations! We are pleased to offer you readmission to Rice University's Department of Chemical and Biomolecular Engineering (CHBE) PhD program. You will be receiving a formal letter with details in the mail soon. The graduate admission committee enjoyed reading your personal statement and was impressed with your accomplishments. Your research interests in nanotechnology will fit well with many of the research interests of our faculty and I have no doubt that you will find several interesting research opportunities.

If you have any questions, do not hesitate to contact myself or Ms. Christine Hughes, our department coordinator, at chbe@rice.edu.

Warm regards,

Professor Sibani Lisa Biswal

Chair of Graduate Admissions

Assistant Professor

Chemical and Biomolecular Engineering

Rice University MS 362

6100 Main Street

Houston, TX 77005

Phone: 713-348-6055

www.ruf.rice.edu/~biswalab

This was big all right! RICE has always taken the cream of NITK and with Prabha already getting an admit into the Bioengg dept, I was also thrilled to learn Deepti had got into the same program as I. With the full tuition waiver + $24,000 per year atleast I am now apprehensive of what to tell BPCL. I have till the 30th of March to let them know of my confirmation to the medical test on June 2nd and thus have been procrastinating in this decision till the very last minute. Like I said before: Too many choices is just as bad as too few :(

Oh and did I mention I have yet to hear from Albany??

Incident '09

2009-03-05T07:28:00.003+05:30

Notice the badge:-

Put simply its a representation of the theme for Incident '09: "Beyond Expression"

What is Incident you ask? Well if thats the case then you missed a hell of a show brother! Incident is the cultural fest of NITK Surathkal and is regarded as one of the best 5-day fests in India. When you have about 4000 students and over 100 colleges participating, you know you are in for a wild ride...

Inci this time didn't disappoint- Check out the official site (Thanks again Kiran for that wonderful website) here.. Use the map and the bot well and you will be getting a trip of NITK (Well, almost!)

I was not present for Day 0 as there is practically nothing on those 4 hours except the Easten Musicals. Speaking of musicals, for the first time ever in Incident history we had a live webcast of all major events and recorded videos of most others. Have a look here for that but I must warn you that the vidoes are huge and need a fast & unlimited internet connection if you need to watch it all in proper manner.

So the next day, Feb 26, was Day 1 (D-uh!) and I had the Ju-Jitsu workshop. As usual NITK followed a timezone 1-1.5 hrs behind IST and I had ample time to get myself a pair of shorts before realising none else had even bothered. Those 2 hours were really great as we were taught several holds and locks apart from a few falls, throws and "Life saving and Deadly" techniques- The instructor's words, not mine.. Oh did I mention I got manhandled by a final year trical girl when we were practising a few moves? *SHUDDER*

Once the gruelling session of Ju-Jitsu was done, I went over to the main building and the Artist Forum had done some really great work there:-

They also had this art exhibition going on which saw some most remarkable work:-

The last 4 were by a girl in class 9 of school! Talk about talent..

More coming up..

My meeting with a "Far-Seer"

2009-02-25T07:37:00.006+05:30

No, I am not kidding here! There was this guy advertised as someone who knows all about you despite never having met you before and would then give you tips on the future.. So I simply HAD to go see for myself, pretty sure this guy was a hoax.

The day was Sunday, 22/02/09 (3 days ago) and I was in Gurpur, a small town by the shores of the river Gurpur (Click on the map for a bigger image):-

There was some family occasion at the community hall over there and then I learnt of this guy at the Sri Varadraya Venkatramana Temple. This temple is believed to have been built in 1712 A.D; Punar-pratista was done in 1952.

So we all went- Everyone else with reverence for the guy and I with skepticism drooling from my lower lip. First up was my younger brother: The guy actually told about him (my brother) being in class 10 and being an average student at best, and went on to tell him to do blah-blah-blah for getting more marks. At this point I was a little interested but then it could have been deduced by any smart chap.

Next up: Me! He looks at me and tells I am an engineer and wish to go for higher education... WTF??? There is NO WAY he knew about me and at this point I was shell-shocked and would have remained so had he not opened his trap again. He says: There are economic issues so getting a job is difficult. Is that so?? Take a look:-

Strike 1!

I controlled my smirk successfully. Next he tells me I havent prepared anything for the higher education process so I need to do so soon. He tells me to take TOEFL next month as it is a lucky month for me:-

Strike 2! It was getting harder to not laugh out loud.. He then tells me I am generally silent and experience sudden bouts of anger. Well nothing anyone can tell to that, except that he is wrong! STRIKE 3 AND YOU ARE OUT!!

I was gloating with a sick smile on my face looking at everyone else there and showing them I was right about this guy being a fraud when, and I never expected this, my cousin sister went up to him...

He tells: Canara Engineering College, Electronics & Communication, 63.2% marks, no job yet, only 12 in her class of 74 placed so far etc etc for about 3 mins. All facts, no guesses!

I was not ready for this, especially after my "glorious victory". That guy told everything precisely to 2 significant figures accurately about her. I desperately wanted to be told that he somehow knew this, that my cousin had talked to him before but she and everyone else vehemently denies it to this day.

Is he a seer or a fraud? I have my reservations about him and the entire world of "men-of-God" but that day was not the most normal of days..

Engineer: An audio-visual look at the magical event!

2009-02-18T07:01:00.004+05:30

Before I proceed, take a look at the promo video:-

I guess that gave a good insight into Engineer as far as the sort of events held but this is more like what the students experience:-

Engineer saw participation galore and the actual events began as early as Feb 4th although the inauguration was on Feb 13:-

The two students at either end of the table are Anand Karpatne (Convenor- Engineer '09) and Deepan M.N (President, Student's Union '09). Two of the main committee members:-

Engineer and other fests give a reason to spruce up the college:-

A huge attraction was the laser show on the night on Feb 12. Here are a few pics:-

Any more and it would have lost the magic! The last day had symphony (Pics not yet out) and the last word:-

That is but a teaser, the real video is way too long to put up here. A pic will have to suffice though:-

That was Engineer 2009, and its just a week for an even bigger spectacle: INCIDENT 2009, The cultural fest of NITK which sees about 1200 outside students across 50+ nationwide colleges participating in the only fest involving a private beach.. More on that soon!

Engineer: Day 3

2009-02-17T07:06:00.010+05:30

I thought my work at Engineer was mercifully over but I am not so good on luck lately. Waking up to a call at 8:15 am on Feb 14, I learnt that my "certain skills" were needed, no info on what those skills were. I didnt even have time to see the daily schedule for the day..

So I arrive at the Biotech department at 9:45 am and see a hustle of people going mad with confusion! Turns out it was Blueprint (Chemical) and the paper presentation event was going to start any time.. Mishra was asking others if it was too late to ask me to be the MC for the event but since I had no idea what was going on, he got the job. In comes GOD followed by a Babu (For those not in the know, GOD is Dr. Srinikethan and called so because he is the reigning deity of our department with a working knowledge of simply everything! The time is 9:50 am..

First up: Rajesh Hegde, our pet sacrificial lamb. He somehow finds ways unimaginable to screw himself (Not literally). In this case, the judges were fresh for accepting our sacrifices and Rajesh had no idea he was actually disqualified from the event for having submitted his paper for reviewal in an international conferance.

So in the end an 8-min presentation caused a 14-min Q&A session from the judges where Rajesh was left literally speechless towards the end. Once he was done, he wasted no time blaming us for selecting the judges, the schedule, his entry being selected first etc etc.. YAWN!

Teams from LIT, Nagpur participated well in this and the subsequent event:-

Manoj and Avanti won 2nd prize for their presentation on the SURGE project done at IIT, Kanpur:-

The winner of this event was Parvathi, 3rd year Chemical Engineering, NITK Surathkal. No pics I have of her, and she actually won 3 events this day!!

After a quiet lunch downstairs, it was time for IDP or Industry Defined Problems at 2 pm and there was a total of 5 teams across 2 problem statements. Prof. Saidutta agreed to be the judge with the usual wit while Dr. Rajmohan made a surprise entry later (Even we were surprised though we were luckily covered with sufficient judge sheets and mementos). The aforementioned Parvathi won again while my personal favourite was this guy from SAIT, Bangalore who showed via a working model the use of piezoelectricity:-

All through the event both judges gave their comments to all teams regarding the poor preparation for the event and then gave more comments at the end. Frankly, I thought the teams deserved a lot more criticism as their work was nearly all shoddy!

So after the event is over and Chemical events at Engineer finally come to an end (Modal Combat was an online event), a quick visit to the Artist Forum room close by to see the work for Incident (Just 9 days away now) and then onto see the much awaited Velocity...

This event held in the sports ground saw self designed remote controlled cars race against each other in a rubber tyre capsulated track and was great fun:-

As far as the finals went, it was not as exciting when one of the top teams collided into the tyre wall but the last 2 laps and the ending was magnificent.. Here take a look at this video:-

That was the end of day 3, amidst smart-ass comments on Valentine's day this was a great day!

Engineer: Day 2

2009-02-15T19:49:00.004+05:30

Like I said before, I was involved in the chemical events and hence this day saw me spend nearly all the time in the Chemistry lab.

Task at hand: Breakdown finals at 1 pm and we got problems.. I arrive at 10 am to find none there! Getting "helpers" by 10:30 was no good, we all mostly lingered around uselessly till the lab assistant came and took 1 list of full chemicals needed for analysis of ANY chemical you can think of, only to let us know that the "poison" of our choice was out of stock..

As only good engineers can, we improvised then and there and Arati made a stunning decision to switch the eliminated chemical with another having, as it turned out, completely different physiological symptoms but then we were the organisers so a simple disclaimer took care of it all.. So far so good right? WRONG!

A trip to CCC to get the corrections done and printouts taken only to discover the lab assistant refusing to give access to all chemicals requested (about 45 of them), things were beginning to look ugly when Arati (Yet again! Bless her..) made another list having a lot less chemicals; I guess a moral victory for LabMan was all he wanted as things went their way again. Time now: 11:30 am, 1.5 hours to go..

We discover absence of chemicals needed for analysis of some chemicals and I get this brainstorm of declaring them as "too dangerous to handle with bare hands" hence eliminating that particular problem. Of course a certain chemical (Nope, not telling which one: LabMan doesnt know too) went "missing" during the event itself but the participants were fully under our control by then to complain -_-

The time is 12:25 pm and no positive test for two chemicals which are in the event! One (Oxalate) was solved by getting a positive result for another test while we had to scrounge literature for getting another test for the cation of the 2nd chemical which as it turned out later, was not required at all as the anion was present only here..

So there was time for a Samosa Chaat from Pande's food stall at Engineer (If you ever happen to be in the vicinity, I will personally treat you at Pande's stall; not the lame drop-up for Engineer but the original one a lil farther off) and the event begins at 1:15 pm..

Funniest thing? I had had a crime scene made up involving a circular chalk background in which was another chald outline of a body. That was it! But the innocent teams spent as much as 15 mins trying to see what's in there and a team actually asked me if the presence of a dead bee (pushed in by mistake by another team) had any significance.. We all knew it was bad on our part to keep them in the dark but what the heck? We were all having a lot of fun seeing them there :D

Finally the process of eliminations began and by the end 1 team stole the show by winning while the rest were still 2 rounds behind! Spot no. 2 was close, and spot no.3 still closer.. In the end all teams acknowledged the results fairly which is more than what I can tell for some certain teams who, after learning they weren't qualified for the finals for the 3rd time from us, went and told on us to the chemistry professor present there: Sour grapes!!

Once the mayhem of breakdown went down, Contraption going on in the inner room took centre stage (or the only stage if you will) and a team actually got as close as 29.88 secs to the set target of 30 secs! For more on the event click here!

I must thank all the participants of these two events and more so the committee members: Saurav, Preet, Arati, Meera, Prasoonna (Hope I got that spelling right), Pravin, Buddesh and Saklini, I remember none else.. I was however dumb enough not to take any pics of these events!!

That was supposed to be Day 2 for me, But sadly the news of the demise of Bijay Sandha (I knew him personally) in a train accident rocked us all as the "Final Year Jinx" continued for the 4th year (or so I know, none really keep count) in succession... Hum Yaad Rakhenge Tumhe, Yaar!

Engineer: Day 1

2009-02-13T06:53:00.004+05:30

My day was spent mainly in front of a flat pc in an air conditioned room! Came to the college at 10 am and was busy making the final event of Breakdown with other people involved...

Noticeable, however, was the usual registration desk and this time the ENGI kit was in the form of a back-bag, the flimsy college variant of course! Lots of people coming here for the 1st time armed with digicams, were searching for scenes worth shooting and ended up taking pics of dumb notice board... I wonder if they didn't know of the beach/mangalore??

So far so good! I didnt get any chance to see even a single event but hopefully it will change from today. The prelims of Break-down were classified as a success as there were 41 teams participating and the quality of the teams was high. In case you dunno or are too lazy to click on the link provided in the last post, BreakDown prelims is a objective paper of Organic/Physical/Inorganic Chemistry and also Methods of Instrumental Analysis.. The finale will be a lot more challenging I can promise that!

So the top 12 were selected based on marks obtained (Total of 75 questions, 1.5 hrs) and these will participate in the finale today afternoon. Got a lot of calls late night from guys who didnt get the result (IT'S ON THE SITE AND IF YOU DIDN'T GET THE RESULT THEN YOU HAVEN'T QUALIFIED!!) Also on the cards today is Contraption, a event which draws a lot of attention too.

Hopefully this day goes well...

Engineer is upon us!

2009-02-12T07:18:00.003+05:30

Today is Feb 12th, 2009 and apart from my friend Manoj's bday today will be more known for the start of Engineer: The techfest of NITK, Surathkal. Of course some online events have already been held and they have given an indication of the popularity of this fest. Take online sudoku for example where people from over 44 countries spread across 6 continents participated in full measure.

Have a look here for full information on what Engineer is, and here is the list of events for the day, click on the links for details on the event:-

1) KPMG Six Sigma Workshop: 1 pm to 9 pm

2) Ad-Venture: 3 pm to 8 pm

3) Marathon: 3 pm to 6 pm; 7 pm to 8 pm

4) Mind-Bend prelims: 3 pm to 5 pm

5) Nirvahana: 3 pm to 7 pm

6) Automata prelims: 4 pm onwards

7) Guest Lecture by Tim Poston: 4 pm to 6 pm

8) Perfect Machine prelims: 6 pm to 11 pm

9) Student Innovators: 4 pm to 7 pm

10) Rectify prelims: 5 pm to 6 pm

11) Break Down prelims: 6 pm to 7 pm

12) Science Quiz prelims: 8 pm to 9 pm

13) Biz Quiz prelims: 9 pm to 10 pm

14) Video Conferance with Dr. Lutz Richer: 9 pm onwards

15) Geodesica prelims: 5 pm to 7 pm

So what is in it for you? Well I say go for BREAKDOWN! That's my event and I promise it will be worth every second of your time and more... But thats true of all events at Engineer, so why are you still here? Engineer is upon us, Are You Attending???

Losing something Precious...

2009-02-12T06:30:00.004+05:30

It had been a long time since I had gotten my dogs; about 5-6 years back. But what I remember most was that we had bought them on Oct 2nd..

Yesterday one of my dogs (Rocky), expired. He was having some sort of allergy from sunday and the vet diagnosed it as asthma/congested heart. It was in all probablity a heart attack and we found him not breathing in his den at 9:45 pm... I just hope it was quick and painless for I last saw him at 5:45 pm and he appeared dull yet very much alive!

Seems harsh even now as his body is still where it was found, we need to get some labourers to bury him in our backyard. I cant help feel what effect this is going to have on our other dog: Being of the Doberman breed, the two were together all this while and I hope the other wont give up on depression.

The worst part was that I was the only one in my family to not shed a tear, hell even the neighbours cried for Rocky was just that good! Is it just me or do I no longer have the heart to do something human?? I know I have changed the last 4 months and I care very little for people who have disappointed me.. But the least I can do is remember him, I guess for the rest of my life...

R.I.P ROCKY: 02-10-2003 TO 11-02-2009

Thanks for everything pal, you were loyal till the end!

Last Quarter of Undergrad college!

2009-02-10T06:35:00.003+05:30

Its official! Once your midsems end, you enter the 4th quarter of the 4th year (For me atleast) and well this is it: No more midsems in NITK and the chance to be involved in my last Engineer and Incident and most importantly- No more of the college life here which was fun, even as a dayscholar!

The midsems this time? Well with 2 subs you got a 50% chance of getting 1 good and 1 bad- Trust me that is the case in final sem! So it was too, CRD was a major bust and BRD was simply rhetorical but thats the case till the marks are out..

In 2 days the techfest Engineer commences and I got work there, maybe because I want to give to my college something which I can remember for a long time! But I cant help consider the situation in 2 months when its all coming to an end, there is a reason the final sem is called the "Senti-Sem" or sentimental semester..

GATE Keeping!

2009-02-10T06:14:00.003+05:30

For some reason my friends expect me to write on the GATE (Graduate Aptitude Test in Engineering) and I find myself indeed writing this. But before I write on how the GATE was for me, let me take this chance to tell you why GATE saw so much more participation this year: SUCKING ECONOMY! I know, "sucking" isnt even a word but sometimes such letters written together make more of an impact..

So with campus placements on the fall and education abroad hit, good ol' GATE had had to be the last resort for quite a few and so when I arrived on the morning of Sunday, Feb 8th, the first thing I noticed was the buses: With the national highway 17 being upgraded into a 4 lane most buses prefer NOT to stop at the dust bowl bus stand of NITK but here most buses stopped and out came major numbers of students and parents (WTF??) alike.. Pretty sure over 700 ppl were here!

If you wanna know what the GATE is, then you are at the wrong place (Click here or here) but hey if you are jobless enough to read more then be my guest!

So where was I? Ah yes, I must let you know I was NOT PREPARED for GATE (Too much Capslock??). What with the apping and placements combined with the midsems and the work for the 2 fests (A not of them soon), and the lack of interest in everything lately, studying for GATE was non-existent! And it was so bad I must have been the only one to not even know the syllabus in its entirety.. And then there was the pattern change!

60 questions, 100 marks with 1/3rd negative marking for a wrong answer. I came there for the heck of it and was major pissed off to learn I couldnt leave the exam hall till the end (9:30 am to 12:30 pm) and so most of my time was spent observing the various specimens of the human species around! But for others in my class this was an important exam for reasons mentioned above, and some were pretty disappointed. Hope the result proves otherwise (Out on March 15th)..

I turn 21

2009-02-03T06:55:00.004+05:30

So I survived another year when the clock struck 6 15 pm on Feb 2nd: Big deal!!

Well actually it is a big deal as it was my last bday in college, I wanted to celebrate it loudly but exams resulted in division of the classmates as per schedule and then there was the Car Festival in Mangalore ( Yesterday was the big parade and today is the celebration of colours called Okli, exactly like Holi but a lot more wilder and populous) so nothing eventually happened..

The usual sms tradition continued as the day began at 12 am and I got no sleep till 12 30, then had to wake up again at 1 am for round 2! I appreciate all the wishes but as the day progressed I realised that some friends, hell even just acquaintances, I took for granted wished me while some "close" friends did not- Did that bother me? Honestly no!

After a certain age, this whole "birthday bash" thing loses its charm and I think it was over 5 years ago for me.. Sure you finally hear from some old friends and far-off cousins but I have grown nonchalant over relatives recently.. Maybe its fault that I no longer care what many of the "friends" do, but I think that suits me just fine!

I did get over rs 1k in cash and loads of clothing apparels which is the advantage of having a Bday coinciding with the annual Konkani festivals in Mangalore and I hogged on food like never before, so glad I can work it out in the gym!

So if I happen to be here on Feb 2nd, 2010 I will write but at the rate I am losing interest in trivial matters as this, its doubtful...

The Tale of the Tramp

2009-02-03T06:42:00.004+05:30

A friend of mine wrote this down when he was in one of his creative moods:-

I gazed upon the street
Below the shining lamp,
I thought it was just plain rags;
But it was actually a tramp

I pitied on his condition
Walked up to his domain,
I looked into his eyes,
And felt some distant pain.

I felt into my pouch,
Placed some money on my palm,
Held it for this pitiful tramp,
And he took it from my arm.

He opened his mouth to thank me,
But instead came a cough
I moved forward to console him;
But he fell down with a puff.

He seemed like a god’s reject,
And I felt pity on this tramp,
- felt an urge to help this man
This man besides the lamp.

I picked him up and
To the clinic I took him,
The tramp was now awake…
But still looked pretty grim

The doctor came in
With a pint of the drug,
He went to the sink
And put some water in the jug.

He then took the mixture,
And poured it down the tramps throat;
The tramp suddenly felt better
And I went to get my coat.

To pay the doctor,
I got up from my couch;
I paid the money –
Right out of my pouch.

Then as we left,
The tramp thanked me,
He took out his stick...
And waked away slowly

He left me on the pavement
With a goodness in my heart;
I had just helped a man
Who lived with fits and starts

Later that night,
I walked to the nearest bar
I felt very elated as,
I had healed a man’s scar.

I grabbed a seat,
And got me a glass of wine
Reminiscing ‘bout the tramp’s domain,
Where the lamp still shines

I reached out for my pouch,
As I started to leave;
You see – this pitiful tramp…
…was also a thief!

---AmC

Nice huh? I liked it and hope you did too! There is a lesson to be learnt here but as you can tell from this earlier post (Click Here), I didnt learn it!!

Something Funny!

2009-02-02T08:22:00.004+05:30

Today being my birthday I decided to just out up a few exceptional jokes I noticed in the joke column in my blog..

1) Newspaper Clippings

Washer. Owned by clean bachelor who seldom washed -- $100.

Snow blower for sale. Only used on snowy days.

Free puppies. Part German Shepherd, part dog.

Cows, calves never bred. Also, one gay bull for sale.

Free puppies: part Cocker Spaniel, part sneaky neighbor's dog

Full-sized mattress. 20-year warranty. Like new. Slight urine smell.

Found: dirty white dog. Looks like a rat. Been out for a while. Better be reward.

Nice parachute. Never opened. Used once. Slightly stained.

Free Yorkshire Terrier. Eight years old. Unpleasant little dog.

Tired of working for only $9.75 per hour? We offer profit sharing and flexible hours. Starting pay: $7 - $9 per hour.

2) Fortune Cookie says---

-- Passionate kiss like spider's web. Soon lead to undoing of fly.

-- Virginity like bubble. One prick, all gone.

-- Man who run in front of car get tired.

-- Man who run behind car get exhausted.

-- Foolish man give wife grand piano. Wise man give wife upright organ.

-- Man who walk thru airport turnstile sideways going to Bangkok.

-- Man with one chopstick go hungry.

-- Man who scratches butt should not bite fingernails.

-- Man who eat many prunes get good run for money.

-- Baseball is wrong -- man with four balls cannot walk.

-- War doesn't determine who is right. War determines who is left.

-- Wife who put husband in doghouse soon find him in cathouse.

3) Blonde's Alligator Shoes

A blonde was on vacation in the depths of Louisiana. She wanted a pair of genuine alligator shoes, but didn't want to pay the high prices.

After unsuccessfully haggling with of one of the shopkeepers, the blonde said, "Maybe I'll just go out and catch my own alligator, so I can get a pair of shoes at a reasonable price."

Later in the day, the shopkeeper spotted the young woman standing waist deep in the water, shotgun in hand. She took aim at an alligator, killed it and hauled it onto the swamp bank.

Lying nearby were several more of the dead creatures. The shopkeeper watched in amazement as the blonde flipped the alligator on its back and shouted in frustration, "Damn, this one isn't wearing any shoes either."

Chinese New Year at Cx!

2009-02-02T06:55:00.007+05:30

Firstly, Happy Chinese New Year for all who care! 2009 is the year of the Ox and well, its a good way to have a zodiac based on animals and not star constellations..

So why the interest for me? Well I learnt that the food chain Chefs-Xinlai have opened a fusion restaurent "Cx" (Although the "C" looks pretty different) in Mannagudda and yesterday I happened to be in the vicinity only to learn that they had a Cantonese Chef brought here for a week (Jan 26- Feb 1) and had actually made a menu for this week only incorporating the guy's original chinese recipes: No people, Gobi Manchurian is NOT chinese, its actually an Indian creation believe it or not!

I thus decided to go there yesterday afternoon and was really surprised by the extent of "China" they brought in here: The outside is full of Chinese paper decorations in the shape of the famous Paper lanterns, Dragons and Chinese Letters and just outside the inner area is a small outer section with a couple of tables and the setting is in accurate chinese style (Watch any of the chinese martial art movies and you will see the tables and the walls in one scene atleast), but the real treat is inside..

I guess air conditioning is a given these days but what about Chinese herbs and aromas giving a soothing fragrance to the decor? Speaking of decor, more paper decorations hung from the ceiling and, according to the waiter atleast, the background song was from a recent film of a very famous chinese actress Ariel Lin (http://en.wikipedia.org/wiki/Ariel_Lin). So far so good, I was already impressed with the extent of originality and the waiters looked chinese but thats true for most dhaba's also here lol..

In comes a waiter with a special menu and the regular one, I didnt even open the regular menu! The special menu had 4 sides of food items and most of it made me think of american tv serials where they talk about the food and I go- WTF is that?? Not this time! The waiter patiently explains to me what all the food items are and its gets tougher to decide what to take the longer he talks..

Finally i decide on a course of Chicken Dumplings (Starters), Spicy Chicken in Royal Thai Sauce and the Chinese Festival Special Fried Rice (Although I also wanted to try the Kwaithyao/Meifoon for the main course)! The starters were excellent in the sense that they were delicious with no frying and also light on the palate while the Saucy Chicken was succulent like hell.. The main course was Seafood endowed with Prawns, Fillet fish, Squid, Crab and something I am yet to identify along with Blue cabbage, green tomatoes and blood-red carrots.. My best thought was the table ware: The plates were real different in shape and the dumplings actually came in a steam basket:-

Here is the Thai Chicken:-

Sadly I got no pic of the rice items as I had them parcelled, but the icing on the cake, and it actually didnt spoil my mood, was when I was leaving the restuarent and the owner tells me to come again- IN KONKANI!! Now he pretty sure heard me speaking in konkani as I was talking there but I was surprised at that..

If you want a treat of the actual chinese eating experience (Or atleast as close as I got), head over to Cx, Mannagudda main road!

Those BRD classes!

2009-01-31T07:09:00.002+05:30

BRD stands for BioReactor Design and it is one of my two subjects in my final semester of undergrad college. For reasons hitherto unknown, my department could not find a tacher for it despite having the highest number of teachers per student in NITK. So we got news of a guest faculty, a Mr Karanth, who would be coming in late Jan to take up the subject.

For those who came in late: Semester started on Dec 10 and till BRD began I had 4 hours per week of college (Sweet!!) and so when the guy finally came it was a bit of a bore to realise he will be taking a lot more extra classes to make up for the lost time- "Bore" was an understatement..

We all knew he was, well, retired to put it kindly and with Indians most retired profs are like teddy bears- All affectionate and gushing kindness! I cant be blamed for thinking the guy was in this category too and actually he was, but it was not his personality that was the issue!

Across 4 straight days, we had atleast 14 hours of classes in seven 2-hour sessions, a "break" between sessions was of help only to those who took advantage of the guy's attendence policy. It maybe sad to tell, but when you are in final sem you really lose seriousness in studies when your life after college is already set! So all that was to be taken care of was the attendence criteria of minimum 75% classes getting attended..

But when you have 14 classes in 4 days you can go down to 72% if you miss a single day of action. This was where our "training" kicked in. You see with time we get trained to notice weaknesses in other people- We cant help it, Survival of the Fittest still runs in our blood! Mr Karanth had a really exploitable way of taking attendence where he would look down at the registration sheet and never look up as he called name rolls, do I need to say whether or not the proxy system was a huge success??

Learning this strategy took 2 days though and for the 1st few days most people actually attended the classes, the breakthrough was provided by Gaurav Singhai who showed it pays to sit near the door as he left not 2 mins into the class after attendence once the prof's back was to us! Can I blame him?? Well not in this case believe it or not!

As I said before, "bore" was an understatement in this case. It is not the guy's fault- Most engineers are better off learning new applications or solving problems others cant and hence most in my class sufferred badly at the extent of theory sessions in this subject. Adding to the misery were the M.Tech people who we shared the subject hall with (Although a couple of them were cool enough to simply walk in/out of the class when desired), and a certain M.Tech guy got my goat more often than not- The feeling was shared by many others I am certain...

Saurav Mishra quoted the most fitting comment for the marathon session when he woke up from his slumber in a seat behind me to blabber "There is a limit to persevere anything!" before slipping back to deep sleep (How does he do that?? I wish I knew, that would be so helpful in class) and when the marathon finally ended all were just relieved- No joy, for all energy was sapped trying to get what was being taught! Next week we got the midsemester exams for the same subject, all I know is that reading our answer scripts the prof is more likely to LOL than be satisfied..

Republic Day??

2009-01-27T07:26:00.002+05:30

So yesterday was Jan 26th and India celebrated 60 years of being a democracy: How did we celebrate? By being focussed more on the Solar Eclipse (Which never came through) and relaxing on a 3 day weekend than even participating in a Flag-Hoisting event!

What about me you ask? No different! I watched the parade on tv which itself was a farce with that thick fog and the terror alert across the nation after sunday's Noida capture of some "pakistani" terrorists..

Sunday night I had a reunion with some of the guys of my class 12 and a topic of discussion was the plan of one of my friends to join politics. If you are reading this, then I guess you shall not be surprised by the reactions of everyone else at that table (I initiated the discussion so I refrained till the end): They laughed out loud (lol??) at him and chastised him for the "dumb" decision.. I knew then I saw this scene somewhere before but couldnt place where until yesterday! Anyway I actually took his side because despite all the talk on India being famous at the moment from the movie Slumdog Millionaire which shows the dirty secrets of the Indian slums and most if not all Indians actually having a moment or two of resentment against being typecasted like that, India is and always will be a nation which will be shown on Discovery and History channels because we have that much to offer to the rest of the world.

Yesterday I was going through the tv guide when I saw it: Rang de Basanti- The Aamir Khan starring film which had grabbed the attention of a billion people in the film as well as in real life when it was launched. The scene where the guys criticize India and the politicians brought in me a sense of Deja-vu of the earlier day! If you havent watched that movie yet, get a version with subtitles in case you do not understand Hindi: It is NOT a film for Indians, it is a film for the world as a whole.. And I am more proud of it than I am of Slumdog Millionaire!

So here we are- the festivities of Republic Day being shodden down to a couple of events involving hoisting the Indian Flag and garlanding the statue of Dr Ambedkar.. More interest is garnered by shows involving celebrities or dare-devils performing feats of courage. But dont judge us by this: We may not be as expressive of our freedom as a generation 50 years ago but only because we have gotten used to it and why shouldnt we? When push comes to shove the entire nation stands united! Show me a place elsewhere where 6 billion people bickering a day ago stand hand-in-hand the next because a united calamity has befallen them..

Maybe democracy has lost its sheen but India certainly has not!

The bad and the ugly of a bus-stop!

2009-01-20T06:52:00.003+05:30

No I am not writing in general about what's good and what needs changes in an Indian Bus-stop, rather its something I was a spectator to yesterday!

After college ended at 4:15 pm, I walked over to the bus stop hoping to get a quick ride home but no, it wasnt to be. But boredom was far from coming as 2 sources of "interest" kept nagging at me the entire 22 minutes I was there..

I saw a man sprawled across the ground behind the place, amidst the rubbish around. A fleeting moment of concern changed over to disgust when I realised he was so drunk, he passed out on a pile of dog-poop! But since he was still breathing, the bad part of that incident lost interest from me- mainly because the ugly was just rearing its head in front of me..

I couldnt help overhear a girl of 18 (2nd semester, NITK) complain loudly to her mom about pain in her leg and like the curious Indian that I am, I snatched a glance at the aforementioned leg only to see she was rocking it back and forth like nothing had ever happened! A man in his late 40's (Who I learned was her Dad) gave me a sheepish grin just before I realised that brown smear across the drunk was dog poop and that took my attention for a while..

Not for long! Daughter thinks she needs to raise her voice even more and so she does! This time everyone else in the vicinity look at the hullaboo.. She tugs at her mom's saree until mom out of exhasperation decides to grant her attention to the former:

Mom: What now?

Daughter: I am not returning here, I just want to know you are aware of it

Dad: This is not the time or place to talk about it, wait till we get home

Daughter (Who shall from now be referred to as 'Brat'): No I want to talk now and thats whats gonna happen!

Mom: Ok we heard you, you told us about this decision many times before.. But we feel its not right

Dad: And thats my final decision! Now dont make a fool out of yourself, ppl are looking at us (I wasnt actually, I thought I saw a service bus but turned out to be an Express bus.. I could hear them though- as was most of NITK I guess)

Brat: I am losing my physics midsem due to this leg pain, so this semester is lost!

Dad: Didnt we speak to your teacher? I am sure something can be arranged

Brat: I dont care! I lost the essence of being able to enjoy engineering studies last sem itself, you ppl dont care about me so sent me here again despite my protestations.. My leg hurts! It hurts!

Mom: I know it hurts but will making such a scene relieve the pain?

Brat: I dont care! You ppl got enough money so that I neednt work at all, I still do some correspondence course for your happiness..

Dad: Enough of that!

Dad walked over to Brat in anger and then...

Hey my bus! I climbed abroad and left for home.. But I still think about Brat and what happened to her. I know all the ppl around (Minus one drunk) would have loved to see her get spanked by Dad but he seemed too decent a chap to do that- atleast in public! I seriously hope Brat never returns to NITK, she doesnt deserve it.. Pity on her parents though!

Branch Diaries!

2009-01-17T06:49:00.003+05:30

A BOND LIKE NO OTHER – The Chemical Engineering Chronicles

Prof to Freshie: “So, What do Chemical Engineers do?”

Freshie: “…”

Prof to Final Year: “So, What do Chemical Engineers do?”

Final Year: “…”

Even though it appears like we still don’t know what it is that chemical engineers really do, the fresher and the final year are blank for different reasons. The fresher because he doesn’t know and the final year because he cannot decide whether we are a) universal engineers or b) glorified plumbers or c) are you mad? Don’t answer questions asked by Professors in the Department!

Helping the blank fresher make the transition into the blank final year were eight long semesters, in the time-span of which the thermodynamically stable system that was a Chemical Engineering student’s head was subjected to several dynamic disturbances, as a result of which the flow of mass, heat and momentum into the stable system was reversed and there was significant loss to the atmosphere (the professors really intended for it to be the other way).

First year in the ATB with our Materialistic Friends turned out to be just the very beginning of a long journey where we all realized that chemical engineering is not a state function but very much a path function. The Chemistry cycle brought with it the banes of Engineering Graphics, Workshop and Chemistry Lab, not to mention the courses themselves. This semester was marked largely by the eccentricities of the Workshop foreman, who found our Bro to be a suitable object of affection. The Graphics Instructor(s), who came in various shapes, sizes and colours (pink!?) tried to force a few fundamentals of drawing into our highly-resistant brains. Chem Lab was always an engaging experience, with the smallest mistakes somehow being caught, and parents’ numbers being taken down before you could bat an eyelid. Also noticeable about this semester was the speed with which we ran through our Math faculty; there one moment, gone the next! Also worthy of mention is the Electronics faculty, who had a mysterious blind-spot to one particular section of the class, and hypnotized the rest with his keychain. The Chemistry faculty, who scheduled tests that truly surprised one and all, refused entry to any who entered nanoseconds after the bell. Professional Communication saw groups trying, and failing, to have meaningful discussions, and trying to pronounce “Ms” appropriately; something most of us are still struggling to do. (Muss? Miss? Muzz?)

While we barely managed to survive the first semester, second semester proved to be a cake-walk. Or so we thought! The Physics cycle brought with it the unpleasant prospects of Programming as well as Electrical Engineering, a subject that saw us achieve our lowest scores yet. C Programming classes, as well as labs, had most of us in a loop with seemingly no way out, and yet, due to the eventual kindness of our faculty, all ended well. The Introduction to Program classes, aimed at exposing us to the many opportunities that awaited successful Chemical Engineering graduates, did little to appease us, but the wonderful placements of the then Final Year batch, as well as the numerous admits to prestigious Universities, did assure us that we had a future after all.

The end of this semester saw the exit of Pramod and The SneezeMaster to Tronics, Hitesh to IITB (after being caught in class preparing for the same), Misha to Scotland, and our Meta brethren to their own Department. We would be welcoming two new members to our fold, Darshan from Meta, and the one and only Chaatu, generous enough to leave the Civil Dept and join us. While most of us spent the first year still coming to terms with the hostels, the mess, the mess in the mess, the novel use of buckets, glass plates and lamps for Graphics, what all “GB” stood for and the other nitty-gritties of NITK life, two of us found their true calling, and figured out how they would be spending a greater part of their life in college.

Preet decided that he would top.

Kaiya decided that he would sleep.

Year 2:

Third Semester:

Enter the Department. After all that we had heard about the Dept from various sources, we still maintain that nothing had prepared us for what awaited us here. The very first class led to absolutely no momentum being transferred, whereas the Process Calculations course introduced us to the art of getting lesser marks than the number of questions in the paper. Most of the class was left deciding between Bhat & Vhora and the notes, and giving up on both the day before the exam. It was also jarring to realize that our drawing days hadn’t come to an end after all, or even that we would ever have to bother finding out what a lathe does. So while metal we hammered, and valves we drew, what purpose they served, no one knew. Row, however, escaped by sticking her little finger into the lathe, obtaining a minuscule, but strategically placed cut, and letting the foreman finish her model for her, while standing behind him and wincing convincingly from time to time.

This semester was not without its merits though – We spent several entertaining hours in our OC and BC courses where our instructor convinced us that we had to synthesize Mandelic acid and not Mandodhari acid, and that auto-catalysis was not catalysis performed in an autorickshaw. This subject once witnessed an attendance of 1/34, and on another memorable occasion, the instructor had to slide the Surprise Test question papers under the prone forms of Kaiya, our champion snoozer, and Prabha, who had decided that two was company.

These diaries would be incomplete without a tribute to our Most Senior Professor. He was the one that gifted us with a very rewarding equation - Unit Test Paper + Mid Sem Paper = End Sem Paper, which helped us all obtain very commendable grades in the subject concerned, as well as a slew of quotable quotes like – “Deviyon aur unke paas baithnewale sajjanon”… “kabhi kabhi aisa bhi hota hai...shayad..aisa hi hota hai!”.. to mention a few.

This semester also saw the emergence of one of the greatest singers of our age. After a brief display of public grief that still remains a mystery to some of us, he cleared the vocal chords, and began to belt out the latest hits of the day, in a voice that left all of us looking for the source, but rarely finding it. Bansal was christened Saccha Hero while Dhole and Arati took on the titles of Bhaiyya and Bhabhiji respectively. One of the prominent locos became the Class Representative. One more pasted himself to the first bench, and decided that he would give Preet a run for his money. The loco with questionable origins and questionable orientation dedicated “Woh Lamhe” to his deep muse in a very fun Freshers, and has not dedicated songs to girls ever since.

Semester 4:

Fourth Semester brought with it the first two installments of the Transfer Operations courses, as well as 2 labs; in one of which was always present the danger of getting electrocuted, whereas the other one turned into a watery grave for all our ambitions of performing accurate engineering experiments. We were also told not to prepare for tests in a very hot subject, as it was supposed to be of no use whatsoever (And imagine our consternation when we found out that this was true!). While Treybal, an innocent-looking and small book (as compared to other heavyweights like Perry’s) turned out to be utterly unhelpful when we turned to it to understand things like Baker’s Method, Levenspiel, Fogler and Preet would begin to be our constant guides for the next one year. Of tragic note is that even after CET-I most of us still think of a smart Atlas or a Hero whenever anyone mentions a thermodynamic cycle. The lone Chemistry course was the only one with the surprise test element still being retained in it, much to the dismay of all those who would happily return five minutes late from a dash to the erstwhile SNP. It was also becoming habit for us by now to refer to Preet’s notes more than all the other reference books combined, as these usually came with timely help from the great author himself. This semester ended with the aforementioned singer switching from songs of tragedy to nostalgia (?) and Sandy suffering from a very well-timed attack of -------- to explain his (lack of) attendance in the Reaction Engg course. Mote began to look to the Middle East this sem while Chaatu tried unsuccessfully to take Bhabhiji out to dinner.

Year 3:

Semester 5:

This semester will largely be remembered as the one in which we had our Heat Transfer Lab. HT Lab was literally hell - where boiling oil, steam and fumes enveloped one and all. Dehydration, burns and trouser-ripping became commonplace, boiler and heat exchanger efficiencies crossed 300%, and data manipulation became the order of the day. The climax of this harrowing experience was a Viva Voce that would put all others to shame. Confronted by the God Panel, each member of the class returned weak-kneed, wearing expressions that would have made Mishra proud, mumbling under their breath and staring glassily into space. It was later heard that the shock and dismay felt during the viva was entirely a mutual experience. Having been stunned into silence by such gems such as Gogo’s reply to “What is Radiation?” – “Er…. Something that’s neither convection nor conduction?” it is assumed that this was when the Department definitely gave up on our class. Moosa became CR as Alok went on to become GenSec. The thoroughly mismanaged Humanities course as well as Process Instrumentation saw hilarious presentations with Arun Chandra stealing the thunder in both of them with his outstanding examples of closed and open systems as fluid flowing inside and outside the human body(!??), and the example for Hair Hygrometer (“Yes, any hair is ok”). Mass Transfer - II saw us all stitching together graph sheets that stretched across blocks, trying to draw tie-lines and measure reflux ratios, while McCabe-Thiele and Ponchon-Savorit were unanimously voted the most unpopular duos in chemical engineering history. The most memorable incidents of the semester were definitely the trip to Malpe, where Indu appreciated the local waters, ably aided by Gogo and DD, as well as the Chemical Class Sadanand Treat.

Semester 6:

Undoubtedly the most challenging of them all, this semester was an endurance test, what with 4+ hour TA lab sessions, as well as 8-10 hours a week of the emotionally and aurally crippling PDC + PMS courses. There was some relief provided, however, by the much-loved Most Senior Professor, who returned with his formula - Unit Test Paper + Mid Sem Paper = End Sem Paper, and MT lab, which coincided magnificiently with the many power cuts common to the summer term, and consequently saw attendances as high as 2/8 labs. Arati ably demonstrated the art of sympathetic bunking, by not turning up for the lab whenever her partner Kaiya “fell ill”. The class appreciated the many curves and figures that were part of the Engineering Economics course, but failed to grasp anything beyond that. Biochemical Engineering saw us prepare from unarguably the best set of 45 slides ever compiled (crickets are crunchy, dog and cat meat is special and microbial fermentation led to the formation of Israel in the First World War). Several people were naturals at BCE due to their familiarity with the products being discussed – wine, beer, cheese and bread.

The person who handled this sem the best was probably Row, who took it upon herself to show the class time and again how to finish writing exams before the invigilator had even finished distributing the question papers.

People started to think of what they would like to do with their lives – and several interned at IITK (a sudden Surge was experienced), IISc, MRPL, Coromandel Fertilizers etc (although it is reported that Mishra would have liked to intern at MRPL instead). Several discoveries were made that were thus far unknown – Shiva’s multiple girlfriends, Arun Chandra’s philosophy that two are better than one and Tripathi’s switching from songs of nostalgia to romance. The semester ended with a bang especially for Kaiya, who, at Inci ’08, certainly joined the beat, but failed to land on his feet.

Final Year:

Semester 7:

It had finally arrived! Some of us had arrived before the others (in 3^rd semester itself) but when the highly awaited Final Year came upon us, we were all so ecstatic that we refused to show up at the Department. Rejected by Kollywood and Sandalwood, the Dark Knights descended upon us, along with the much-feared God. We are largely at a loss as to what really happened in class as none of us were present. During the exams however, PDCE had us frantically rifling through Perry’s Handbook for half an hour and finally finding an equation or a correlation totally irrelevant to the problem at hand. CPI had us drawing many boxes and many more lines to connect them, and filling the boxes with text that we imagined was appropriate. Chemical Process Optimization was the elective from hell, with the grades also being severely optimized. PE, which was taken with the third years, saw unexplainably higher attendance from some people. Macha proved to be smarter than the rest when he harassed everyone during their CPI presentations but answered all harassing questions directed at him during his.

Placements:

Kiran Kumar kick-started Placements 2009 with a brilliant job at Oracle. Indu was placed in TCS while Row became the new Reddy Aunty. Darshan got the highly coveted IOCL job, and Bro, DD and Deba were placed in BOC. Chaatu is off to HSBC (“I will make it GSBC in some time. Just keep watching!”), and Sachin and Varun got into BPCL. Kaiya and Dhole got into Futures First, while our CR landed a job at Mu-Sigma. Moosa and Mishra both got two jobs, and are likely to take up Coca-Cola and L&T respectively. Bansal and Gogo were placed in Tech Mahindra. Swapna & Raj got placed in Accenture while Christi got a PPO from her intern company in Dubai.

Attendance:

This semester saw an unbelievable slump in attendance, with GRE, CAT and Placement preparations being some of the more plausible excuses, and latest episodes of House MD and “no one was there in the block to wake me up” the less plausible ones. Having attended more placement treats than classes this semester, our attendance percentages had an average of 45% in most courses, ranging from 9% (Kaiya and Dhole) to 65% (no prizes for guessing who). For reasons that even he cannot explain, DD ended up with the highest attendance in PCSPI. With the introduction of the new FA grade, the two weeks prior to exams were spent wondering if we would be allowed to write them at all. However, the Department saved our behinds yet another time and we escaped mostly unscathed.

Kaiya: “Sir, I am placement coordinator…”

God: “How did you always have placement work at 8AM?”

Kaiya: “……”

Kodachadri:

Eighth Semester:

With minimal course-load, most of the class was involved in Engi and Inci. Kiran’s mind-blowing Inci website was the talk of the town. While DD, as LSD Con of both, was frequently seen making trips to and from GB (which one?) on Inci and Engi duty, Dhole, as the Publicity Coordinator for Engi, came to classes with the sole purpose of telling people about the Engi events. Dhole’s and Alok’s stellar dance performance during DJ Nite at Inci was captured by Deepti.

For the first time in 3 years, we had a course handled by a visiting professor. This novel concept became clear to us, when the Mysore Brother finally arrived 2 weeks before the mid-sem exams, and began to teach, stopping only a week later, well after most of the class had sidled out through the back door, never to returm. This course led to much friction between the class as to who would exit after the first hour and who would have to sit through it. Amicable settlements were reached with turns being taken to exit in the morning and evening session. The mandatory Technical Seminars proceeded ever so slowly with various excuses being offered from bringing in shortcuts to incompatibility of versions to laptops crashing, etc.

App Scene:

At the time of going to print, Prabha proposes to pursue a PhD in Bioengineering at Rice U and Suhas intends to head off to RPI to major in Control Systems. Panicker and Deepti have received admits from Clemson U and U Florida. Preet and Rajesh look all set to head off to either IISc or an IIT. Several more admits are anticipated.

Highly awaited are the final class trip, App Treats, Farewell and Ring Ceremony and more fights between Tripathi and Chaatu on the Google Group.

Miscellany:

Unanswered Questions:

1) Why did Tripathi cry?

2) How did Prabha convince Acharya to pass her despite lack of attendance?

3) How was Kaiya busy in 7^th Semester?

4) Kaun Chota Chaatu aur kaun Bada Chaatu?

5) Did any guy learn Economics in 6^th sem?

6) Why was Varun Shenoy researching Barbies at IISc?

7) How does Row leave the exam hall so early?

8) What happened to that Class T Shirt that DD has been designing since 2^nd sem?

Quotable Quotes

1) Mishra: (In response to Dhole’s concern) Abey main darra hua nahin,bhagwan ne
aisa mooh hi diya hai toh kya karoon?

2) Prof. Adhikari: Listen Mister, Hurry brings worry not Shri Hari ok? So take your time with experiments…

3) Singhai: The name is Gaurav Singhai

4) Tripathi : She is a dumb

Multiple Choice Questions

Lab Partners made in heaven

1) Christina and Deba
2) Arati and Yuvraj
3) Sandeep and Nikhil

Better late than never to class

1) Prabha
2) Indu
3) Dhole

Epilogue:

Our Department is fond of calling us a family. At the end of four years, we have come together across several barriers to truly become one. Being sandwiched between two very nerdy batches, we were happy to be the slackers, taking things easy and making having a good time the most important thing. Chemical Engineers at NITK are a unique and slightly crazy bunch, and we’ve definitely kept up the tradition. Wherever we all head off to pursue our lives and careers, the four years we’ve spent here at the Chem Engg. Department were surely among the most amazing years ever.

Salutations, Chemical Engineers of the Batch of 2009!

Dramatis Personae:

CR, Saccha Hero, Christi, Deba, Dee, DD, Hardik, Gogo, Indu, Kiran, Manoj, Shivakumar, Panicker, Prabha, Preet, Ragayjesh, Moosa, Bro, Sachin, Mishra, Dhole, Row, Su, Swap, Varun, Macha, Arati, Arun Chandra, Tripathi, Kaiya, Sandy, Sanjay, Darshan, Chaatu.

Nerd Havana!

2009-01-14T17:41:00.003+05:30

I realised a long while ago I needed another blog to write on stuff specific sections of the audience here relate to! Quite a lot of my friends (Not classmates) are into gaming, WWE, books/TV and the latest electronic gadgets so I made a blog on wordpress (Blogger is still better!) for that: NERD HAVANA and ya: This is also my blog so dont blame me for advertising :D

I got a lot of posts pending to be posted here, but only after my apping procedure is fully finished! Cya till then..

Nooooooooooooooooooooo!!!!!!!!!!!!

2009-01-02T07:05:00.009+05:30

I was going through Abhishek Upadhya's blog (http://nitklogik.blogspot.com/) and there was a post about a site which predicts the gender of the person behind a blog or homepage..

I was warned its pretty new and has a lot of chances to go wrong but hey I was roaming the net like a pack of wild dogs across the Serengeti and decided to give this blog the chance to re-affirm my status as Alpha Male.. Oh my ego! My poor, poor ego!

I am possibly 56% female??? Noooooooooooooooooo!!!!!!!!!!!

But wait, I can test it out on my friends and see if this rubbish is right or not! So here I present my findings on blogs I know:-

Ravi Nigam (Male): 87% Female

Sourabh Dhole (Male): 77% Female

Yatin Kamath (Male): 80% Female

Abhishek Upadhya (Male): 58% Female

Puneet Aggarwal (Male): 56% Female

Kaushik Lakshman (Male): 98% Female

Nikhil Rao (Male): 52% Male

Sougata Khan (Male): 3 blogs with 61% Male, 67% Female and 82% Female

FUFY (Bunch of Males): 52% Female

Akshata Rao (Female): 71% Female

NITK Numbskulls (2 Females): 99% Female

Sudarshna (Female): 95% Female

Some big names:-

Aamir Khan (Male): Blog contains non-english characters (hehe)

Shobhaa De (Female): 56% Female

Amitabh Bacchan (Male): 65% Female

Anna Kournikova (Female): 83% Male

Britney Spears (Female): 56% Female

Kim Kardashian (Female): 66% Female

Donald Trump (Male): 94% Male

Pamela Anderson (Female): 57% Male

Paris Hilton (Female): 81% Male

Rosie O'Donnell (Female): Error Occurred (No wonder she is a lesbian!)

Victoria "posh" Beckham (Female): 61% Female

And some websites themselves:-

Incident website: 94% Male

Engineer Website: Blog contains non-english characters (???)

Google: 100% Female

Yahoo: 55% Female

WWE: 88% Male

NITK website: 64% Male

GenderAnalyzer itself: 66% Female

No wonder that site is still in its primitive stages! So feel free to explore the gender of other sites like Google or Yahoo but at your own risk:- http://genderanalyzer.com/

And so 2008 ends!

2009-01-01T10:58:00.004+05:30

The whole world is celebrating New Year's Day with the usual group mail, sms ( If its still free that is!), calls and face-to-face greetings. Last night was supposed to have ppl awake till 12 am so that they could greet each other for the next year. I ask what is so special here? All you have done is manage to survive another year!!

But wait! Dont we also "celebrate" the birth and death anniversaries of many, many people? Its become so much a social convention these days that our 1st reaction to the death of an ex-politician is not "Who is he? What has he done?" but rather "Are we gonna get a holiday for his death then?"...

Enough of this melancholy! Last week the entire world got through Christmas and then the usual began:-

1) Prepare a list of people to wish, important enough for greetings via phone etc etc

2) Get that 2009 calender! Of course you will probably get about 5-8 of them but dont we all want one big calender of huge pics to flaunt in the drawing room?

3) Whats with that tradition of a company gifting New Year Diaries and Desk Calenders for the next year? What is one supposed to do with a Diary anyway when you got PDA's and Smart Phones??

4) Oh I hate this part with passion: All sorts of "experts" decide to bless us with a list of "Achievers and Losers of 2008" in all fields from Cricket to Wall Street. I can understand a newspaper extra giving a recap of the year gone by but whats with the news channels spending 3 hours of prime time television to show us news we have ALREADY seen before (Most of which we rather not watch again too!)..

5) Here we are on Dec 31st. Why do ppl assume I need to attend a function with booze, booty and buxom wenches (Arrr, looks like I am getting affected by my Facebook Pirate language option)?? Cant we spend the time with family? Of course that would mean watching tv channels showing either "Tele-Idiot Awards" or "Dance, you Dunces: All the way to 2009" shows.. Maybe that function idea is not that bad! Hmmm...

6) Jan 1st! One of my good friends was born this day and to his utter dismay, few remember it for that occasion.. Apart from that I find another west-world tradition catching up here. No, I dont refer to the gifts n' greetings; I speak of Resolutions!

New Year's Resolutions?? I would rather it be the WWE pay-per-view I was talking about but not everything in this world is as you desire.. I find this a complete timepass activity! If you wanna do something, then get it done the day you thought of it and not wait till Jan 1st.. I admit some people actually get insipid inspiration from a resolution for a new year but the vast majority make noises that empty pot of lore would be proud of.

Speaking of funny resolutions:-

New Years Resolutions

for 2009

This year, I resolve to:

Always replace the gas nozzle
before driving away from the pump.

I will always "check for paper"
when leaving the restroom.

I will try to drive closer to the speed limit.

I will always wear clean underwear, "just in case".

I will keep an extra safe distance when driving behind police cars.

I will no longer park the BMW
next to fire hydrants.

and never again will I try to diffuse an explosive device with a known practical joker.

And here are a few resolutions you can actually keep:-

1. I want to gain weight. Put on at least 30 pounds.2. Stop exercising. Waste of time. 3. Read less. 4. Watch more TV. I've been missing some good stuff. 5. Procrastinate more. 6. Drink. Drink some more. 7. Take up a new habit: smoking. 8. Spend at least $1000 a month on Ladies of the Night. 9. Spend more time at work. 10. Take a vacation to someplace important: like to see the largest ball of twine. 11. Stop bringing lunch from home: I should eat out more. 12. Quit giving money & time to charity. 14. Start being superstitious. 15. Have my car lowered and invest in a really loud stereo system. Get the windows tinted. Buy some fur for the dash. 16. Speak in a monotone voice and only use monosyllabic words. 17. Only wear jeans that are 2 sizes too small and use a chain or rope for a belt. Only wear white T-shirts with those fashionable yellow stains under the arms. 18. Personal goal: bring back disco.

So to finally end this post which belive me I could have continued a lot more but for want of time, Have a Great Year everyone!! I am putting up a DeviantArt design which I liked a lot:-